From PneumoWiki
Jump to navigation Jump to search
PangenomeTIGR4
serotype 4
D39
serotype 2
D39V
serotype 2
Hungary19A-6
serotype 19A
EF3030
serotype 19F
670-6B
serotype 6B
6A-10
serotype 6A
70585
serotype 5
A026
serotype 19F
A66
serotype 3
AP200
serotype 11A
ASP0581
serotype 12F
ATCC 49619
serotype 19F
ATCC 700669
serotype 23F
BVJ1JL
serotype 1
CGSP14
serotype 14
G54
serotype 19F
HU-OH
serotype 3
Hu15
serotype 19A
Hu17
serotype 19A
INV104
serotype 1
INV200
serotype 14
JJA
serotype 14
MDRSPN001
serotype 19F
NCTC7466
serotype 2
NU83127
serotype 4
OXC141
serotype 3
P1031
serotype 1
R6
serotype 2
SP49
serotype 19A
SPN032672
serotype 1
SPN034156
serotype 3
SPN034183
serotype 3
SPN994038
serotype 3
SPN994039
serotype 3
SPNA45
serotype 3
ST556
serotype 19F
TCH8431/19A
serotype 19A
Taiwan19F-14
serotype 19F
Xen35
serotype 4
gamPNI0373
serotype 1

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SPNOXC_RS09650 [old locus tags: SPNOXC17630 SPNOXC_17630 ]
  • symbol: SPNOXC_RS09650
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1787547..1788431
  • length: 885
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_017592 (1787547..1788431) NCBI
  • BioCyc: SPNOXC_RS09650 BioCyc
  • MicrobesOnline:
  • PneumoBrowse for strain D39V: SPV_1801 PneumoBrowse

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACGGTGGTTAAAGTTGAAAAATTGAGTAAGAAAATAAAAGACAAGGAAATTTTGCGG
    AACATCTCCTTTGAAATCAACGATGGTGAATGTGTTGCCTTAATTGGTCCAAATGGTGCC
    GGAAAGACAACACTCTTAGATTGTTTGCTTGGAGATAAACTGGTCACAAGCGGTCAAGTA
    TCTATTCAAGGTTTACCAGTGACGAGTTCTAAGTTAGACTATACTAGGGCTTACCTCCCT
    CAAGAAAATGTAATCGTTCAGAAATTAAAAGTTAAAGAGTTGATTGCTTTCTTTCAACGT
    ATCTATCCAAATCCTTTGAGCAATCAGGAAATTGATCAACTATTGCAGTTTGTCAAGCAA
    CAAAAAGAACAGTTGGCAGAAAAATTATCAGGCGGTCAAAAGCGTCTCTTTTCTTTCGTC
    TTGACCTTAATTGGGCGACCAAAGATTGTTTTTTTAGATGAGCCTACTGCGTCCATGGAT
    ACCTCAACTCGTCAACGTTTTTGGGAAATTGTCCAGGAGTTAAAAGCGCAAGGAGTCACC
    ATTCTCTATTCGTCCCATTATATTGAGGAAGTGGAACACACTGCAGACCGCATTTTGCTC
    TTAAATAAGGGAGAGTTGATTCGAGATACGACGCCTCTAGCTATGCGTAGCGAGGAAATA
    GAAAAGCACTTTATCCTTCCTATAGCTTACAAGGAAGTCGTAGAGCAGTCAAATTTGGTT
    GAAAACTGGACCCTAAAGCAAGATTCTTTACAAGTAGTCACTCGAGAAGCAGATGCTTTC
    TGGGAACTATTAGCTCAAGCAGGATGTAGGATGCAAGAAATCGAAGTTAATAATCGTAGT
    TTGTTGAATACAATCTTTGAAGAGACGCAGAAGGGAGATAACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    885

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SPNOXC_RS09650 [old locus tags: SPNOXC17630 SPNOXC_17630 ]
  • symbol: SPNOXC_RS09650
  • description: ABC transporter ATP-binding protein
  • length: 294
  • theoretical pI: 5.29969
  • theoretical MW: 33509.4
  • GRAVY: -0.251361

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 151)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 127.1)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 127.1)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 121.8)
    and 77 more
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 120.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 116.2)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 115.6)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 114.1)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 114.1)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 112.9)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 110.7)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 109.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 105.6)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 103.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 100.1)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 100.1)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 99.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 99.2)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 99.1)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 98.6)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 97.1)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 96.8)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 96.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 94.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 92.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 92.2)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 89.9)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 89.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 89.1)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 88.4)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 88.2)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 87.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 85.8)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 82.4)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 80.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 78.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 77.8)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 77.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 76.7)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 76.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 75.8)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 75.5)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 74.8)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 73.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 73.2)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 72.2)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 72.2)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 70.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 70.5)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 70.5)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 67.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 65.5)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 65.5)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 64.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 63.4)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 63.4)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 63.4)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 63.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 63.1)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 62.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 60)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 57.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 54.8)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 54.8)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 53.2)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 53.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 50.1)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 49)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 47.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 28)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 22.3)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 16.5)
    rad50 (TIGR00606; HMM-score: 16)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 14.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 14.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 13.2)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 13.2)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 13.1)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 12.6)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 12.1)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 11)
  • TheSEED: see SPNOXC17630
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 91.8)
    and 28 more
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 61.5)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 34.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 25.8)
    AAA_23; AAA domain (PF13476; HMM-score: 25.2)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 22.8)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 21.8)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 20.6)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 19.3)
    AAA_22; AAA domain (PF13401; HMM-score: 17.6)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 17.2)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 16.8)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16)
    AAA_33; AAA domain (PF13671; HMM-score: 15.8)
    KdpD; Osmosensitive K+ channel His kinase sensor domain (PF02702; HMM-score: 15.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 14.5)
    no clan defined PSD5; Protein of unknown function (DUF1595) (PF07637; HMM-score: 14.1)
    PilZN; Flagellar regulator YcgR, PilZN domain (PF07317; HMM-score: 13.9)
    P-loop_NTPase (CL0023) AAA_14; AAA domain (PF13173; HMM-score: 13.8)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 13.3)
    AAA_24; AAA domain (PF13479; HMM-score: 13.2)
    no clan defined SpoVIF; Stage VI sporulation protein F (PF14069; HMM-score: 12.9)
    P-loop_NTPase (CL0023) DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 12.9)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 12.7)
    AAA_28; AAA domain (PF13521; HMM-score: 12.6)
    DO-GTPase2; Double-GTPase 2 (PF19993; HMM-score: 12.5)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 12.3)
    AAA_25; AAA domain (PF13481; HMM-score: 12.2)
    AAA_30; AAA domain (PF13604; HMM-score: 12)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.04
    • Cytoplasmic Membrane Score: 9.96
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.074931
    • TAT(Tat/SPI): 0.000396
    • LIPO(Sec/SPII): 0.000548
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_000219356 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTVVKVEKLSKKIKDKEILRNISFEINDGECVALIGPNGAGKTTLLDCLLGDKLVTSGQVSIQGLPVTSSKLDYTRAYLPQENVIVQKLKVKELIAFFQRIYPNPLSNQEIDQLLQFVKQQKEQLAEKLSGGQKRLFSFVLTLIGRPKIVFLDEPTASMDTSTRQRFWEIVQELKAQGVTILYSSHYIEEVEHTADRILLLNKGELIRDTTPLAMRSEEIEKHFILPIAYKEVVEQSNLVENWTLKQDSLQVVTREADAFWELLAQAGCRMQEIEVNNRSLLNTIFEETQKGDN

Experimental data[edit | edit source]

  • protein localization:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Expression data[edit | edit source]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

NCBI: 20-DEC-2020

Summary[edit | edit source]

  • organism: Streptococcus pneumoniae OXC141
  • locus tag: SPNOXC_RS09650 [old locus tags: SPNOXC17630 SPNOXC_17630 ]
  • pan locus tag?: PNEUPAN003540000
  • symbol: SPNOXC_RS09650
  • pan gene symbol?: yxlF
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SPNOXC_RS09650 [old locus tags: SPNOXC17630 SPNOXC_17630 ]
  • symbol: SPNOXC_RS09650
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1787547..1788431
  • length: 885
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_017592 (1787547..1788431) NCBI
  • BioCyc: SPNOXC_RS09650 BioCyc
  • MicrobesOnline:
  • PneumoBrowse for strain D39V: SPV_1801 PneumoBrowse

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACGGTGGTTAAAGTTGAAAAATTGAGTAAGAAAATAAAAGACAAGGAAATTTTGCGG
    AACATCTCCTTTGAAATCAACGATGGTGAATGTGTTGCCTTAATTGGTCCAAATGGTGCC
    GGAAAGACAACACTCTTAGATTGTTTGCTTGGAGATAAACTGGTCACAAGCGGTCAAGTA
    TCTATTCAAGGTTTACCAGTGACGAGTTCTAAGTTAGACTATACTAGGGCTTACCTCCCT
    CAAGAAAATGTAATCGTTCAGAAATTAAAAGTTAAAGAGTTGATTGCTTTCTTTCAACGT
    ATCTATCCAAATCCTTTGAGCAATCAGGAAATTGATCAACTATTGCAGTTTGTCAAGCAA
    CAAAAAGAACAGTTGGCAGAAAAATTATCAGGCGGTCAAAAGCGTCTCTTTTCTTTCGTC
    TTGACCTTAATTGGGCGACCAAAGATTGTTTTTTTAGATGAGCCTACTGCGTCCATGGAT
    ACCTCAACTCGTCAACGTTTTTGGGAAATTGTCCAGGAGTTAAAAGCGCAAGGAGTCACC
    ATTCTCTATTCGTCCCATTATATTGAGGAAGTGGAACACACTGCAGACCGCATTTTGCTC
    TTAAATAAGGGAGAGTTGATTCGAGATACGACGCCTCTAGCTATGCGTAGCGAGGAAATA
    GAAAAGCACTTTATCCTTCCTATAGCTTACAAGGAAGTCGTAGAGCAGTCAAATTTGGTT
    GAAAACTGGACCCTAAAGCAAGATTCTTTACAAGTAGTCACTCGAGAAGCAGATGCTTTC
    TGGGAACTATTAGCTCAAGCAGGATGTAGGATGCAAGAAATCGAAGTTAATAATCGTAGT
    TTGTTGAATACAATCTTTGAAGAGACGCAGAAGGGAGATAACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    885

This data comes from external databases and cannot be edited.

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SPNOXC_RS09650 [old locus tags: SPNOXC17630 SPNOXC_17630 ]
  • symbol: SPNOXC_RS09650
  • description: ABC transporter ATP-binding protein
  • length: 294
  • theoretical pI: 5.29969
  • theoretical MW: 33509.4
  • GRAVY: -0.251361

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 151)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 127.1)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 127.1)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 121.8)
    and 77 more
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 120.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 116.2)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 115.6)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 114.1)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 114.1)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 112.9)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 110.7)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 109.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 105.6)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 103.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 100.1)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 100.1)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 99.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 99.2)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 99.1)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 98.6)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 97.1)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 96.8)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 96.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 94.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 92.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 92.2)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 89.9)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 89.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 89.1)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 88.4)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 88.2)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 87.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 85.8)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 82.4)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 80.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 78.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 77.8)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 77.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 76.7)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 76.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 75.8)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 75.5)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 74.8)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 73.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 73.2)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 72.2)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 72.2)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 70.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 70.5)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 70.5)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 67.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 65.5)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 65.5)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 64.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 63.4)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 63.4)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 63.4)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 63.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 63.1)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 62.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 60)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 57.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 54.8)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 54.8)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 53.2)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 53.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 50.1)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 49)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 47.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 28)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 22.3)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 16.5)
    rad50 (TIGR00606; HMM-score: 16)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 14.2)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 14.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 13.2)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 13.2)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 13.1)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 12.6)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 12.1)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 11)
  • TheSEED: see SPNOXC17630
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 91.8)
    and 28 more
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 61.5)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 34.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 25.8)
    AAA_23; AAA domain (PF13476; HMM-score: 25.2)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 22.8)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 21.8)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 20.6)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 19.3)
    AAA_22; AAA domain (PF13401; HMM-score: 17.6)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 17.2)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 16.8)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16)
    AAA_33; AAA domain (PF13671; HMM-score: 15.8)
    KdpD; Osmosensitive K+ channel His kinase sensor domain (PF02702; HMM-score: 15.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 14.5)
    no clan defined PSD5; Protein of unknown function (DUF1595) (PF07637; HMM-score: 14.1)
    PilZN; Flagellar regulator YcgR, PilZN domain (PF07317; HMM-score: 13.9)
    P-loop_NTPase (CL0023) AAA_14; AAA domain (PF13173; HMM-score: 13.8)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 13.3)
    AAA_24; AAA domain (PF13479; HMM-score: 13.2)
    no clan defined SpoVIF; Stage VI sporulation protein F (PF14069; HMM-score: 12.9)
    P-loop_NTPase (CL0023) DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 12.9)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 12.7)
    AAA_28; AAA domain (PF13521; HMM-score: 12.6)
    DO-GTPase2; Double-GTPase 2 (PF19993; HMM-score: 12.5)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 12.3)
    AAA_25; AAA domain (PF13481; HMM-score: 12.2)
    AAA_30; AAA domain (PF13604; HMM-score: 12)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.04
    • Cytoplasmic Membrane Score: 9.96
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.074931
    • TAT(Tat/SPI): 0.000396
    • LIPO(Sec/SPII): 0.000548
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_000219356 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTVVKVEKLSKKIKDKEILRNISFEINDGECVALIGPNGAGKTTLLDCLLGDKLVTSGQVSIQGLPVTSSKLDYTRAYLPQENVIVQKLKVKELIAFFQRIYPNPLSNQEIDQLLQFVKQQKEQLAEKLSGGQKRLFSFVLTLIGRPKIVFLDEPTASMDTSTRQRFWEIVQELKAQGVTILYSSHYIEEVEHTADRILLLNKGELIRDTTPLAMRSEEIEKHFILPIAYKEVVEQSNLVENWTLKQDSLQVVTREADAFWELLAQAGCRMQEIEVNNRSLLNTIFEETQKGDN

Experimental data[edit | edit source]

  • protein localization:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Expression data[edit | edit source]

Biological Material[edit | edit source]

This data comes from external databases and cannot be edited.

Other Information[edit | edit source]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]