From PneumoWiki
Jump to navigation Jump to search
PangenomeTIGR4
serotype 4
D39
serotype 2
D39V
serotype 2
Hungary19A-6
serotype 19A
EF3030
serotype 19F
670-6B
serotype 6B
6A-10
serotype 6A
70585
serotype 5
A026
serotype 19F
A66
serotype 3
AP200
serotype 11A
ASP0581
serotype 12F
ATCC 49619
serotype 19F
ATCC 700669
serotype 23F
BVJ1JL
serotype 1
CGSP14
serotype 14
G54
serotype 19F
HU-OH
serotype 3
Hu15
serotype 19A
Hu17
serotype 19A
INV104
serotype 1
INV200
serotype 14
JJA
serotype 14
MDRSPN001
serotype 19F
NCTC7466
serotype 2
NU83127
serotype 4
OXC141
serotype 3
P1031
serotype 1
R6
serotype 2
SP49
serotype 19A
SPN032672
serotype 1
SPN034156
serotype 3
SPN034183
serotype 3
SPN994038
serotype 3
SPN994039
serotype 3
SPNA45
serotype 3
ST556
serotype 19F
TCH8431/19A
serotype 19A
Taiwan19F-14
serotype 19F
Xen35
serotype 4
gamPNI0373
serotype 1

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: MDRSPN_01439 [new locus tag: MDRSPN_RS07545 ]
  • symbol: MDRSPN_01439
  • product: arginine ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1465912..1466670
  • length: 759
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: AP018391 (1465912..1466670) NCBI
  • BioCyc:
  • MicrobesOnline:
  • PneumoBrowse for strain D39V: SPV_0531 PneumoBrowse

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGCTTTAGTAGAATTTAAAAACGTCGAAAAATATTACGGAGACTACCACGCACTCCGC
    AACATCAATCTCCGTTTTGAAAAAGGACAAGTTGTTGTCCTGCTTGGACCTTCTGGCTCT
    GGGAAGTCCACTCTTATCCGTACGATCAATGGTTTAGAGGCTGTTGACAAAGGAAGTCTC
    CTAGTCAATGGGCACCAAGTTGCTGGTGCCAGCCAGAAAGATTTGGTACCTCTTCGCAAG
    GAAGTCGGCATGGTTTTTCAACATTTTAACCTTTATACACACAAAACTGTGTTAGAAAAC
    GTGACACTTGCGCCCGTTAAAGTTCTAGGAATTGATAAAAAAGAAGCTGAAAAAACCGCC
    CAAAAATATCTGGAATTTGTAAATATGTGGGACAAGAAAGATTCCTATCCCGCCATGCTA
    TCTGGTGGACAAAAACAGCGGATCGCCATCGCTCGTGGTCTTGCTATGCATCCGGAACTC
    CTCCTCTTTGATGAACCAACATCTGCTCTTGATCCTGAGACTATCGGAGATGTTCTAGCA
    GTTATGCAGAAACTGGCGCATGATGGGATGAACATGATCATCGTTACCCACGAAATGGGC
    TTTGCTCGAGAGGTTGCGGACCGCATTATCTTTATGGCCGACGGAGAAGTGTTAGTAGAT
    ACGACAGATGTCGATAACTTTTTTGACAATCCAAGCGAACCTCGTGCCCAACAATTCCTC
    AGCAAAATTATCAACCACGAAAGTGACAAAGTCAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    759

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: MDRSPN_01439 [new locus tag: MDRSPN_RS07545 ]
  • symbol: MDRSPN_01439
  • description: arginine ABC transporter ATP-binding protein
  • length: 252
  • theoretical pI: 6.31552
  • theoretical MW: 28096.2
  • GRAVY: -0.177778

Function[edit | edit source]

  • TIGRFAM:
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 279.3)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 235)
    and 80 more
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 205.2)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 200.2)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 199.3)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 197.6)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 197.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 186.2)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 184.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 184.5)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 177.5)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 169.1)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 169.1)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 162.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 160.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 158.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 157.6)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 145.6)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 145.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 144.4)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 139.6)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 138.4)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 138.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 136.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 135.9)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 128.8)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 128.8)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 126.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 126.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 125.9)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 125.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 125)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 125)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 124.8)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 121.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 120.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 119)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 118.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 116.1)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 115.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 115.6)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 114.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 114.4)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 114.1)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 113.3)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 112.9)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 112.5)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 108.6)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 108.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 108)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 102.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 102.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 92.5)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 92.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 89.6)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 89.6)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 87.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 85.7)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 85.7)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 85.7)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 85.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 84.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 76.2)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 74)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 66.8)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 66.8)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 56.7)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 50.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 47.3)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 46.8)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 38.5)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 15.8)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 14.5)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 13.6)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 13.5)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 12.6)
    Metabolism Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12.1)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 11.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 11.5)
    rad50 (TIGR00606; HMM-score: 10.2)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 9.4)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 9.4)
  • TheSEED: data available for Hungary19A-6, TIGR4
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.2)
    and 33 more
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 37.5)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 33.5)
    AAA_13; AAA domain (PF13166; HMM-score: 24.9)
    AAA_30; AAA domain (PF13604; HMM-score: 23)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 22.6)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 22.5)
    ABC_ATPase; ATPase of the ABC class (PF09818; HMM-score: 21.8)
    AAA_23; AAA domain (PF13476; HMM-score: 21.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 19.5)
    AAA_10; AAA-like domain (PF12846; HMM-score: 17.4)
    AAA_22; AAA domain (PF13401; HMM-score: 17)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 16.2)
    AAA_33; AAA domain (PF13671; HMM-score: 15.7)
    AAA_18; AAA domain (PF13238; HMM-score: 15.2)
    DLIC; Dynein light intermediate chain (DLIC) (PF05783; HMM-score: 15.1)
    AAA_24; AAA domain (PF13479; HMM-score: 14.6)
    NACHT; NACHT domain (PF05729; HMM-score: 14)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 13.7)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13.7)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13.5)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 13.5)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.5)
    AAA_PrkA; PrkA AAA domain (PF08298; HMM-score: 13.3)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 13.3)
    Rad17; Rad17 P-loop domain (PF03215; HMM-score: 13.1)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 13)
    G-alpha; G-protein alpha subunit (PF00503; HMM-score: 12.7)
    DAP3; Mitochondrial ribosomal death-associated protein 3 (PF10236; HMM-score: 12.4)
    SH3 (CL0010) SH3_2; Variant SH3 domain (PF07653; HMM-score: 12)
    P-loop_NTPase (CL0023) DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 11.8)
    AAA_28; AAA domain (PF13521; HMM-score: 11.8)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 11.4)
    Adeno_IVa2; Adenovirus IVa2 protein (PF02456; HMM-score: 11.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.008682
    • TAT(Tat/SPI): 0.000577
    • LIPO(Sec/SPII): 0.000543
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: BBA59637 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MALVEFKNVEKYYGDYHALRNINLRFEKGQVVVLLGPSGSGKSTLIRTINGLEAVDKGSLLVNGHQVAGASQKDLVPLRKEVGMVFQHFNLYTHKTVLENVTLAPVKVLGIDKKEAEKTAQKYLEFVNMWDKKDSYPAMLSGGQKQRIAIARGLAMHPELLLFDEPTSALDPETIGDVLAVMQKLAHDGMNMIIVTHEMGFAREVADRIIFMADGEVLVDTTDVDNFFDNPSEPRAQQFLSKIINHESDKVK

Experimental data[edit | edit source]

  • protein localization:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Expression data[edit | edit source]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

NCBI: 05-OCT-2017

Summary[edit | edit source]

  • organism: Streptococcus pneumoniae MDRSPN001
  • locus tag: MDRSPN_01439 [new locus tag: MDRSPN_RS07545 ]
  • pan locus tag?: PNEUPAN001538000
  • symbol: MDRSPN_01439
  • pan gene symbol?: glnQ2
  • synonym:
  • product: arginine ABC transporter ATP-binding protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: MDRSPN_01439 [new locus tag: MDRSPN_RS07545 ]
  • symbol: MDRSPN_01439
  • product: arginine ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1465912..1466670
  • length: 759
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: AP018391 (1465912..1466670) NCBI
  • BioCyc:
  • MicrobesOnline:
  • PneumoBrowse for strain D39V: SPV_0531 PneumoBrowse

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGCTTTAGTAGAATTTAAAAACGTCGAAAAATATTACGGAGACTACCACGCACTCCGC
    AACATCAATCTCCGTTTTGAAAAAGGACAAGTTGTTGTCCTGCTTGGACCTTCTGGCTCT
    GGGAAGTCCACTCTTATCCGTACGATCAATGGTTTAGAGGCTGTTGACAAAGGAAGTCTC
    CTAGTCAATGGGCACCAAGTTGCTGGTGCCAGCCAGAAAGATTTGGTACCTCTTCGCAAG
    GAAGTCGGCATGGTTTTTCAACATTTTAACCTTTATACACACAAAACTGTGTTAGAAAAC
    GTGACACTTGCGCCCGTTAAAGTTCTAGGAATTGATAAAAAAGAAGCTGAAAAAACCGCC
    CAAAAATATCTGGAATTTGTAAATATGTGGGACAAGAAAGATTCCTATCCCGCCATGCTA
    TCTGGTGGACAAAAACAGCGGATCGCCATCGCTCGTGGTCTTGCTATGCATCCGGAACTC
    CTCCTCTTTGATGAACCAACATCTGCTCTTGATCCTGAGACTATCGGAGATGTTCTAGCA
    GTTATGCAGAAACTGGCGCATGATGGGATGAACATGATCATCGTTACCCACGAAATGGGC
    TTTGCTCGAGAGGTTGCGGACCGCATTATCTTTATGGCCGACGGAGAAGTGTTAGTAGAT
    ACGACAGATGTCGATAACTTTTTTGACAATCCAAGCGAACCTCGTGCCCAACAATTCCTC
    AGCAAAATTATCAACCACGAAAGTGACAAAGTCAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    759

This data comes from external databases and cannot be edited.

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: MDRSPN_01439 [new locus tag: MDRSPN_RS07545 ]
  • symbol: MDRSPN_01439
  • description: arginine ABC transporter ATP-binding protein
  • length: 252
  • theoretical pI: 6.31552
  • theoretical MW: 28096.2
  • GRAVY: -0.177778

Function[edit | edit source]

  • TIGRFAM:
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 279.3)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 235)
    and 80 more
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 205.2)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 200.2)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 199.3)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 197.6)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 197.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 186.2)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 184.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 184.5)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 177.5)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 169.1)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 169.1)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 162.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 160.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 158.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 157.6)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 145.6)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 145.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 144.4)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 139.6)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 138.4)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 138.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 136.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 135.9)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 128.8)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 128.8)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 126.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 126.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 125.9)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 125.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 125)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 125)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 124.8)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 121.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 120.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 119)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 118.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 116.1)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 115.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 115.6)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 114.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 114.4)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 114.1)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 113.3)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 112.9)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 112.5)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 108.6)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 108.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 108)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 102.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 102.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 92.5)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 92.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 89.6)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 89.6)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 87.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 85.7)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 85.7)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 85.7)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 85.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 84.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 76.2)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 74)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 66.8)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 66.8)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 56.7)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 50.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 47.3)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 46.8)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 38.5)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 15.8)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 14.5)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 13.6)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 13.5)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 12.6)
    Metabolism Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12.1)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 11.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 11.5)
    rad50 (TIGR00606; HMM-score: 10.2)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 9.4)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 9.4)
  • TheSEED: data available for Hungary19A-6, TIGR4
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 122.2)
    and 33 more
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 37.5)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 33.5)
    AAA_13; AAA domain (PF13166; HMM-score: 24.9)
    AAA_30; AAA domain (PF13604; HMM-score: 23)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 22.6)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 22.5)
    ABC_ATPase; ATPase of the ABC class (PF09818; HMM-score: 21.8)
    AAA_23; AAA domain (PF13476; HMM-score: 21.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 19.5)
    AAA_10; AAA-like domain (PF12846; HMM-score: 17.4)
    AAA_22; AAA domain (PF13401; HMM-score: 17)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 16.2)
    AAA_33; AAA domain (PF13671; HMM-score: 15.7)
    AAA_18; AAA domain (PF13238; HMM-score: 15.2)
    DLIC; Dynein light intermediate chain (DLIC) (PF05783; HMM-score: 15.1)
    AAA_24; AAA domain (PF13479; HMM-score: 14.6)
    NACHT; NACHT domain (PF05729; HMM-score: 14)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 13.7)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13.7)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13.5)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 13.5)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.5)
    AAA_PrkA; PrkA AAA domain (PF08298; HMM-score: 13.3)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 13.3)
    Rad17; Rad17 P-loop domain (PF03215; HMM-score: 13.1)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 13)
    G-alpha; G-protein alpha subunit (PF00503; HMM-score: 12.7)
    DAP3; Mitochondrial ribosomal death-associated protein 3 (PF10236; HMM-score: 12.4)
    SH3 (CL0010) SH3_2; Variant SH3 domain (PF07653; HMM-score: 12)
    P-loop_NTPase (CL0023) DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 11.8)
    AAA_28; AAA domain (PF13521; HMM-score: 11.8)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 11.4)
    Adeno_IVa2; Adenovirus IVa2 protein (PF02456; HMM-score: 11.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.008682
    • TAT(Tat/SPI): 0.000577
    • LIPO(Sec/SPII): 0.000543
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: BBA59637 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MALVEFKNVEKYYGDYHALRNINLRFEKGQVVVLLGPSGSGKSTLIRTINGLEAVDKGSLLVNGHQVAGASQKDLVPLRKEVGMVFQHFNLYTHKTVLENVTLAPVKVLGIDKKEAEKTAQKYLEFVNMWDKKDSYPAMLSGGQKQRIAIARGLAMHPELLLFDEPTSALDPETIGDVLAVMQKLAHDGMNMIIVTHEMGFAREVADRIIFMADGEVLVDTTDVDNFFDNPSEPRAQQFLSKIINHESDKVK

Experimental data[edit | edit source]

  • protein localization:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Expression data[edit | edit source]

Biological Material[edit | edit source]

Other Information[edit | edit source]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]