Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 02-MAY-2018
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae D39
- locus tag: SPD_1688 [new locus tag: SPD_RS08995 ]
- pan locus tag?: PNEUPAN003435000
- symbol: SPD_1688
- pan gene symbol?: tRNA-Ile2-1
- synonym:
- product: tRNA-Met
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: tRNA
- locus tag: SPD_1688 [new locus tag: SPD_RS08995 ]
- symbol: SPD_1688
- product: tRNA-Met
- replicon: chromosome
- strand: -
- coordinates: 1698871..1698944
- length: 74
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: CP000410 (1698871..1698944) NCBI
- BioCyc: see SPD_RS08995
- MicrobesOnline: 1620359 MicrobesOnline
- PneumoBrowse for strain D39V: SPV_1688 PneumoBrowse
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61GGACCTTTAGCTCAGCTGGTTAGAGCTCTCGGCTCATAACCGAGTGGTCGTAGGTTCAAG
TCCTACAAGGTCCA60
74
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SPD_1688 [new locus tag: SPD_RS08995 ]
- symbol: SPD_1688
- description: tRNA-Met
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb:
- DeepLocPro:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_1688 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]