Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 31-JAN-2014
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae Hungary19A-6
- locus tag: SPH_1253 [new locus tag: SPH_RS06065 ]
- pan locus tag?: PNEUPAN000578000
- symbol: SPH_1253
- pan gene symbol?: —
- synonym:
- product: conserved hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SPH_1253 [new locus tag: SPH_RS06065 ]
- symbol: SPH_1253
- product: conserved hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1164336..1164656
- length: 321
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: CP000936 (1164336..1164656) NCBI
- BioCyc: see SPH_RS06065
- MicrobesOnline: 5696085 MicrobesOnline
- PneumoBrowse for strain D39V:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAATGATTTACTCCTTATCCCAGTAATTTTTTTAGCAGTAGGAGGAATTCTCATTCTT
TTATGGAGACTCTTTCTTATTGCCAGTGGACTTTTACTGATTGGTTTTGTCAGTTTTCTT
ATTTTCGTAGAAGTCTATGGAATTTATCTGTTCTTTACAGAGACTGAACTTTACACGGAA
GATTTGGCACAGAATGGATTATTTGGTTTTACGACTTTCTTTATCATCTTTAACCTTGCT
TTGCTTGTCTTGGTAGGCTGGGTAGGGTATAAGTGGAAGAGGGATAATAACGTTTTAGCA
AATCAACGCGATTTTTGGTGA60
120
180
240
300
321
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SPH_1253 [new locus tag: SPH_RS06065 ]
- symbol: SPH_1253
- description: conserved hypothetical protein
- length: 106
- theoretical pI: 4.26676
- theoretical MW: 12261.5
- GRAVY: 1.1066
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED :
- FIG01118149: hypothetical protein
- PFAM: no clan defined DUF5966; Family of unknown function (DUF5966) (PF19391; HMM-score: 88.8)and 6 moreDUF2784; Protein of Unknown function (DUF2784) (PF10861; HMM-score: 10.4)Gram_pos_anchor; LPXTG cell wall anchor motif (PF00746; HMM-score: 9.1)DUF3951; Protein of unknown function (DUF3951) (PF13131; HMM-score: 8.3)DUF4059; Protein of unknown function (DUF4059) (PF13268; HMM-score: 7.3)YlaC; Inner membrane protein YlaC (PF10777; HMM-score: 6.9)Phage_holin_3_6; Putative Actinobacterial Holin-X, holin superfamily III (PF07332; HMM-score: 6.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 10
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 3
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9467
- Cell wall & surface Score: 0
- Extracellular Score: 0.0533
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.000921
- TAT(Tat/SPI): 0.000253
- LIPO(Sec/SPII): 0.031699
- predicted transmembrane helices (TMHMM): 3
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNDLLLIPVIFLAVGGILILLWRLFLIASGLLLIGFVSFLIFVEVYGIYLFFTETELYTEDLAQNGLFGFTTFFIIFNLALLVLVGWVGYKWKRDNNVLANQRDFW
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V:
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]