From PneumoWiki
Jump to navigation Jump to search
PangenomeTIGR4
serotype 4
D39
serotype 2
D39V
serotype 2
Hungary19A-6
serotype 19A
EF3030
serotype 19F
670-6B
serotype 6B
6A-10
serotype 6A
70585
serotype 5
A026
serotype 19F
A66
serotype 3
AP200
serotype 11A
ASP0581
serotype 12F
ATCC 49619
serotype 19F
ATCC 700669
serotype 23F
BM6001
serotype 19F
BVJ1JL
serotype 1
CGSP14
serotype 14
G54
serotype 19F
HU-OH
serotype 3
Hu15
serotype 19A
Hu17
serotype 19A
INV104
serotype 1
INV200
serotype 14
JJA
serotype 14
MDRSPN001
serotype 19F
NCTC7465
serotype 1
NCTC7466
serotype 2
NU83127
serotype 4
OXC141
serotype 3
P1031
serotype 1
R6
serotype 2
SP49
serotype 19A
SPN032672
serotype 1
SPN034156
serotype 3
SPN034183
serotype 3
SPN994038
serotype 3
SPN994039
serotype 3
SPNA45
serotype 3
ST556
serotype 19F
TCH8431/19A
serotype 19A
Taiwan19F-14
serotype 19F
Xen35
serotype 4
gamPNI0373
serotype 1

NCBI: 26-AUG-2017

Summary[edit | edit source]

  • organism: Streptococcus pneumoniae SPN034156
  • locus tag: SPN034156_11810 [new locus tag: SPN034156_RS06635 ]
  • pan locus tag?: PNEUPAN000714000
  • symbol: SPN034156_11810
  • pan gene symbol?: saeR
  • synonym:
  • product: response regulator protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SPN034156_11810 [new locus tag: SPN034156_RS06635 ]
  • symbol: SPN034156_11810
  • product: response regulator protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1222844..1223542
  • length: 699
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: FQ312045 (1222844..1223542) NCBI
  • BioCyc:
  • MicrobesOnline:
  • PneumoBrowse for strain D39V: SPV_0081 PneumoBrowse

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGGAAAGACAATTTTACTCGTTGACGACGAGGTAGAAATCACAGATATTCATCAGAGA
    TACTTAATTCAGGCAGGTTATCAGGTCTTGGTAGCCCATGATGGACTGGAAGCGCTAGAG
    CTGTTCAAGAAAAAACCGATTGATTTGATTATCACAGATGTCATGATGCCTCGGATGGAT
    GGTTATGATTTAATCAGTGAGGTTCAATACTTATCACCAGAGCAGCCTTTCCTATTTATT
    ACTGCTAAGACCAGTGAACAGGACAAGATTTACGGCCTGAGCTTGGGAGCAGATGATTTT
    ATTGCTAAGCCTTTTAGCCCACGTGAGCTGGTTTTGCGTGTCCACAATATTTTGCGCCGC
    CTTCATCGTGGGGGCGAAACAGAGCTGATTTCCCTTGGCAATCTAAAAATGAATCATAGT
    AGTCATGAAGTTCAAATAGGAGAAGAAATGCTGGATTTAACTGTTAAATCATTTGAATTG
    CTGTGGATTTTAGCTAGCAATCCAGAGCGAGTTTTCTCCAAGACAGACCTCTATGAAAAG
    ATCTGGAAAGAAGACTACGTGGATGACACCAATACCTTGAATGTGCATATCCATGCTCTT
    CGACAGGAGCTGGCAAAATATAGTAGTGACCAAACGCCCACTATTAAGACAGTTTGGGGG
    TTGGGATATAAGATAGAGAAACCGAGAGGACAAACATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    699

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SPN034156_11810 [new locus tag: SPN034156_RS06635 ]
  • symbol: SPN034156_11810
  • description: response regulator protein
  • length: 232
  • theoretical pI: 5.17423
  • theoretical MW: 26683.4
  • GRAVY: -0.274569

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 176)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 176)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 159.7)
    and 7 more
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 120.9)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 55.4)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 44.3)
    Signal transduction Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 33.9)
  • TheSEED  :
    • Two-component response regulator SA14-24
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 100.1)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 82.9)
    and 1 more
    IHF-likeDNA-bdg (CL0548) HU-CCDC81_bac_2; CCDC81-like prokaryotic HU domain 2 (PF18175; HMM-score: 11.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.95
    • Cytoplasmic Membrane Score: 0.05
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9947
    • Cytoplasmic Membrane Score: 0.004
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0011
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00231
    • TAT(Tat/SPI): 0.000188
    • LIPO(Sec/SPII): 0.000177
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: CCP36850 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MGKTILLVDDEVEITDIHQRYLIQAGYQVLVAHDGLEALELFKKKPIDLIITDVMMPRMDGYDLISEVQYLSPEQPFLFITAKTSEQDKIYGLSLGADDFIAKPFSPRELVLRVHNILRRLHRGGETELISLGNLKMNHSSHEVQIGEEMLDLTVKSFELLWILASNPERVFSKTDLYEKIWKEDYVDDTNTLNVHIHALRQELAKYSSDQTPTIKTVWGLGYKIEKPRGQT

Experimental data[edit | edit source]

  • protein localization:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Expression data[edit | edit source]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

Stuart J McKessar, Regine Hakenbeck
The two-component regulatory system TCS08 is involved in cellobiose metabolism of Streptococcus pneumoniae R6.
J Bacteriol: 2007, 189(4);1342-50
[PubMed:17028271] [WorldCat.org] [DOI] (P p)
Xin-Ming Song, Wayne Connor, Karsten Hokamp, Lorne A Babiuk, Andrew A Potter
The growth phase-dependent regulation of the pilus locus genes by two-component system TCS08 in Streptococcus pneumoniae.
Microb Pathog: 2009, 46(1);28-35
[PubMed:18983906] [WorldCat.org] [DOI] (P p)
Alejandro Gómez-Mejia, Gustavo Gámez, Stephanie Hirschmann, Viktor Kluger, Hermann Rath, Sebastian Böhm, Franziska Voss, Niamatullah Kakar, Lothar Petruschka, Uwe Völker, Reinhold Brückner, Ulrike Mäder, Sven Hammerschmidt
Pneumococcal Metabolic Adaptation and Colonization Are Regulated by the Two-Component Regulatory System 08.
mSphere: 2018, 3(3);
[PubMed:29769380] [WorldCat.org] [DOI] (I e)