Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 26-AUG-2017
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae SPN994039
- locus tag: SPN994039_07430 [new locus tag: SPN994039_RS03965 ]
- pan locus tag?: PNEUPAN001789000
- symbol: SPN994039_07430
- pan gene symbol?: rsmC
- synonym:
- product: putative methyltransferase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SPN994039_07430 [new locus tag: SPN994039_RS03965 ]
- symbol: SPN994039_07430
- product: putative methyltransferase
- replicon: chromosome
- strand: +
- coordinates: 744435..745016
- length: 582
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: FQ312044 (744435..745016) NCBI
- BioCyc:
- MicrobesOnline:
- PneumoBrowse for strain D39V: SPV_0735 PneumoBrowse
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541ATGTATTATGCAGAAAATCCTGACGCTGCTCACGACATTCATGAGTTGAGAGTAGAGTTG
TTGGGACAAAAAATGACCTTTTTAACGGATGCGGGTGTTTTTAGCAAGAAAATAGTTGAC
TTTGGAAGTCAACTATTGCTCAAGTGTCTTGAGGTCAACCAAGGAGAAACTGTCCTTGAT
GTAGGCTGTGGTTACGGACCTTTGGGTTTGTCCTTAGCTAAGGCTTATGGAGTTCAGGCT
ACTATGGTTGATATCAACACTCGTGCCTTGGATTTAGCTCGGAGAAATGCTGAAAAAAAT
AATGCAAAAGCGACGATTTTCCAGTCCAACATCTATGAACAAGTTGAAGGACATTTTGAT
CATGTCATTTCCAATCCTCCTATCCGTGCGGGCAAGCAAGTCGTTCATGAAATCATTGAG
AAAAGTAAAGATTTCTTGGAAACTGGTGGGGATTTGACAATCGTCATCCAGAAAAAACAA
GGGGCTCCAAGTGCTAAGTCCAAGATGGAGGATGTGTTTGGTAATTGTGAAATCCTTAAA
AAAGACAAAGGATACTATATCCTTAGAAGTGTGAAAGAATGA60
120
180
240
300
360
420
480
540
582
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SPN994039_07430 [new locus tag: SPN994039_RS03965 ]
- symbol: SPN994039_07430
- description: putative methyltransferase
- length: 193
- theoretical pI: 6.67535
- theoretical MW: 21375.4
- GRAVY: -0.268912
⊟Function[edit | edit source]
- TIGRFAM: Protein fate Protein modification and repair protein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 71.6)Protein fate Protein modification and repair methyltransferase, HemK family (TIGR00536; HMM-score: 61.9)and 25 moreUnknown function Enzymes of unknown specificity putative methylase (TIGR00537; HMM-score: 53.3)Protein synthesis Ribosomal proteins: synthesis and modification protein-(glutamine-N5) methyltransferase, ribosomal protein L3-specific (TIGR03533; EC 2.1.1.-; HMM-score: 47.5)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 42)Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 41.5)Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein L11 methyltransferase (TIGR00406; EC 2.1.1.-; HMM-score: 38.5)Protein synthesis tRNA and rRNA base modification 23S rRNA (uracil-5-)-methyltransferase RumA (TIGR00479; EC 2.1.1.-; HMM-score: 36.7)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 3-demethylubiquinone-9 3-O-methyltransferase (TIGR01983; EC 2.1.1.64; HMM-score: 35.4)Protein synthesis tRNA and rRNA base modification ribosomal RNA small subunit methyltransferase A (TIGR00755; EC 2.1.1.182; HMM-score: 28.4)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 28.2)Protein synthesis Ribosomal proteins: synthesis and modification putative protein-(glutamine-N5) methyltransferase, unknown substrate-specific (TIGR03704; EC 2.1.1.-; HMM-score: 27.4)Biosynthesis of cofactors, prosthetic groups, and carriers Biotin malonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 23.6)methyltransferase, Rta_06860 family (TIGR04290; EC 2.1.1.-; HMM-score: 22.8)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll C-20 methyltransferase BchU (TIGR02716; EC 2.1.1.-; HMM-score: 21.6)Cellular processes Toxin production and resistance tellurite resistance protein TehB (TIGR00477; HMM-score: 20.9)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone demethylmenaquinone methyltransferase (TIGR02752; EC 2.1.1.163; HMM-score: 19.9)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides putative sugar O-methyltransferase (TIGR04371; EC 2.1.1.-; HMM-score: 19)Biosynthesis of cofactors, prosthetic groups, and carriers Glutathione and analogs putative 4-mercaptohistidine N1-methyltranferase (TIGR04345; HMM-score: 17.8)Amino acid biosynthesis Aspartate family methionine biosynthesis protein MetW (TIGR02081; HMM-score: 17.5)2-ketoarginine methyltransferase (TIGR04543; EC 2.1.1.243; HMM-score: 14.8)Protein synthesis tRNA and rRNA base modification 23S rRNA (uracil-5-)-methyltransferase RumB (TIGR02085; EC 2.1.1.189; HMM-score: 14.5)Transcription RNA processing 3' terminal RNA ribose 2'-O-methyltransferase Hen1 (TIGR04074; EC 2.1.1.-; HMM-score: 14.1)Protein synthesis tRNA and rRNA base modification 3' terminal RNA ribose 2'-O-methyltransferase Hen1 (TIGR04074; EC 2.1.1.-; HMM-score: 14.1)Protein fate Protein modification and repair protein-L-isoaspartate O-methyltransferase (TIGR00080; EC 2.1.1.77; HMM-score: 14)methyltransferase, FkbM family (TIGR01444; HMM-score: 12.8)Protein synthesis tRNA and rRNA base modification tRNA (uracil(54)-C(5))-methyltransferase (TIGR02143; EC 2.1.1.35; HMM-score: 12.3)
- TheSEED: data available for D39, Hungary19A-6, TIGR4
- PFAM: NADP_Rossmann (CL0063) MTS; Methyltransferase small domain (PF05175; HMM-score: 185.5)and 21 moreMethyltransf_25; Methyltransferase domain (PF13649; HMM-score: 49.3)Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 46.6)PrmA; Ribosomal protein L11 methyltransferase (PrmA) (PF06325; HMM-score: 44.2)CMAS; Mycolic acid cyclopropane synthetase (PF02353; HMM-score: 43.4)Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 32.3)Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 31.5)Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 30.6)Met_10; Met-10+ like-protein (PF02475; HMM-score: 28.5)Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 24.7)Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 24)Ubie_methyltran; ubiE/COQ5 methyltransferase family (PF01209; HMM-score: 23)Cons_hypoth95; Conserved hypothetical protein 95 (PF03602; HMM-score: 22.6)TehB; Tellurite resistance protein TehB (PF03848; HMM-score: 22)PCMT; Protein-L-isoaspartate(D-aspartate) O-methyltransferase (PCMT) (PF01135; HMM-score: 18.5)UPF0020; Putative RNA methylase family UPF0020 (PF01170; HMM-score: 17.9)Methyltransf_16; Lysine methyltransferase (PF10294; HMM-score: 17)MetW; Methionine biosynthesis protein MetW (PF07021; HMM-score: 16.7)NodS; Nodulation protein S (NodS) (PF05401; HMM-score: 14.5)DOT1; Histone methylation protein DOT1 (PF08123; HMM-score: 14)RrnaAD; Ribosomal RNA adenine dimethylase (PF00398; HMM-score: 13.8)tRNA_U5-meth_tr; tRNA (Uracil-5-)-methyltransferase (PF05958; HMM-score: 13.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9909
- Cytoplasmic Membrane Score: 0.0017
- Cell wall & surface Score: 0.0017
- Extracellular Score: 0.0058
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.00777
- TAT(Tat/SPI): 0.000786
- LIPO(Sec/SPII): 0.000954
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: CCP34437 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MYYAENPDAAHDIHELRVELLGQKMTFLTDAGVFSKKIVDFGSQLLLKCLEVNQGETVLDVGCGYGPLGLSLAKAYGVQATMVDINTRALDLARRNAEKNNAKATIFQSNIYEQVEGHFDHVISNPPIRAGKQVVHEIIEKSKDFLETGGDLTIVIQKKQGAPSAKSKMEDVFGNCEILKKDKGYYILRSVKE
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_0735 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]