Jump to navigation
Jump to search
TIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 30-JAN-2014
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae R6
- locus tag: spr0223
- pan locus tag?:
- symbol: spr0223
- pan gene symbol?: —
- synonym:
- product: ABC transporter solute-binding protein - iron transport, truncation
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: spr0223
- symbol: spr0223
- product: ABC transporter solute-binding protein - iron transport, truncation
- replicon: chromosome
- strand: -
- coordinates: 216000..216368
- length: 369
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: AE007317 (216000..216368) NCBI
- BioCyc: SPR0223 BioCyc
- MicrobesOnline: 133108 MicrobesOnline
- PneumoBrowse for strain D39V:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGACTGTTGGTCTCTCTTATGAAGATTCAGCAGTTAAACTCTTAAATGACGGAGCTAAC
ATTAAAGTAGTCTATCCAAAAGAAGGAACCGTCTTCCTACCTGCTAGTGCTGCTATCGTT
AAAAAATCTAAAAATATGGAAAATGCCAAGAAATTTATCGATTTTATTATCTCTCAAGAA
GTACAAGATACACTTGGTACAACCACTACTAACCGTCCTGTTCGTAAAAATGCTAAAACA
AGCGAAAACATGAAACCAATTGACAAAATCAAAACACTCACTGAAGATTATGATTATGTC
ATCAAGAATAAATCAGATATCGTTAAGAAATACAACGAAGTCTTTACAGATATCCAATCT
AAACAGTAA60
120
180
240
300
360
369
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: spr0223
- symbol: spr0223
- description: ABC transporter solute-binding protein - iron transport, truncation
- length: 122
- theoretical pI: 9.75793
- theoretical MW: 13738.7
- GRAVY: -0.539344
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, periplasmic 2-aminoethylphosphonate-binding protein (TIGR03261; HMM-score: 63.6)and 6 moreTransport and binding proteins Other ABC transporter periplasmic binding protein, thiB subfamily (TIGR01254; HMM-score: 29.8)2-aminoethylphosphonate ABC transporter, 2-aminoethylphosphonate binding protein (TIGR03227; HMM-score: 27.7)Hypothetical proteins Conserved TIGR00270 family protein (TIGR00270; HMM-score: 16.4)Transport and binding proteins Anions molybdate ABC transporter, periplasmic molybdate-binding protein (TIGR01256; HMM-score: 16)Transport and binding proteins Other thiamin/thiamin pyrophosphate ABC transporter, thiamin/thiamin pyrophospate-binding protein (TIGR01276; HMM-score: 15.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids carbohydrate ABC transporter substrate-binding protein, CPR_0540 family (TIGR03850; HMM-score: 15.7)
- TheSEED :
- Fe(3+) ABC transporter (EC 7.2.2.7), substrate-binding protein
- PFAM: PBP (CL0177) SBP_bac_6; Bacterial extracellular solute-binding protein (PF13343; HMM-score: 50.9)SBP_bac_8; Bacterial extracellular solute-binding protein (PF13416; HMM-score: 41.1)and 3 moreSBP_bac_11; Bacterial extracellular solute-binding protein (PF13531; HMM-score: 36.1)SBP_bac_1; Bacterial extracellular solute-binding protein (PF01547; HMM-score: 24.1)no clan defined DUF948; Bacterial protein of unknown function (DUF948) (PF06103; HMM-score: 12.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0.1423
- Cytoplasmic Membrane Score: 0.253
- Cell wall & surface Score: 0.0037
- Extracellular Score: 0.6011
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.005634
- TAT(Tat/SPI): 0.00065
- LIPO(Sec/SPII): 0.001379
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTVGLSYEDSAVKLLNDGANIKVVYPKEGTVFLPASAAIVKKSKNMENAKKFIDFIISQEVQDTLGTTTTNRPVRKNAKTSENMKPIDKIKTLTEDYDYVIKNKSDIVKKYNEVFTDIQSKQ
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: ABC-MSP < ABC-MSP < ABC-NBD < spr0223
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V:
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]