Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 08-MAR-2025
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae SP49
- locus tag: BMJ42_RS10230 [old locus tag: BMJ42_01944 ]
- pan locus tag?: PNEUPAN003466000
- symbol: BMJ42_RS10230
- pan gene symbol?: ssbB
- synonym:
- product: single-stranded DNA-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: BMJ42_RS10230 [old locus tag: BMJ42_01944 ]
- symbol: BMJ42_RS10230
- product: single-stranded DNA-binding protein
- replicon: chromosome
- strand: -
- coordinates: 1851478..1851873
- length: 396
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NZ_CP018136 (1851478..1851873) NCBI
- BioCyc: BMJ42_RS10230 BioCyc
- MicrobesOnline:
- PneumoBrowse for strain D39V: SPV_1711 PneumoBrowse
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGTATAATAAAGTTATCATGATTGGGCGTTTAACGTCTACACCAGAATTGCACAAAACC
AACAATGACAAGTCGGTAGCGCGAGCAACTATCGCTGTGAACCGTCGTTACAAAGACCAA
AACGGTGAACGTGAAGCTGATTTTGTCAATATGGTCCTATGGGGCAGACTAGCAGAAACT
TTGGCAAGCTACGCAACCAAAGGTAGTCTCATTTCCGTTGATGGAGAATTGCGTACCCGT
CGCTTTGAGAAAAATGGCCAAATGAACTACGTGACCGAAGTACTTGTCACAGGATTCCAA
CTCTTGGAAAGTCGTGCTCAACGTGCTATGCGTGAAAATAATGCAGGCCAAGATTTGGCA
GATTTGGTCTTGGAAGAGGAAGAATTGCCATTTTAA60
120
180
240
300
360
396
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: BMJ42_RS10230 [old locus tag: BMJ42_01944 ]
- symbol: BMJ42_RS10230
- description: single-stranded DNA-binding protein
- length: 131
- theoretical pI: 5.96709
- theoretical MW: 14925.8
- GRAVY: -0.530534
⊟Function[edit | edit source]
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair single-stranded DNA-binding protein (TIGR00621; HMM-score: 114.2)and 1 moreDNA metabolism DNA replication, recombination, and repair primosomal replication protein PriB (TIGR04418; HMM-score: 15.7)
- TheSEED: data available for D39, Hungary19A-6, TIGR4
- PFAM: OB (CL0021) SSB; Single-strand binding protein family (PF00436; HMM-score: 100.9)and 2 moreDUF3217; Protein of unknown function (DUF3217) (PF11506; HMM-score: 16.4)no clan defined Hypoth_Ymh; Protein of unknown function (Hypoth_ymh) (PF09509; HMM-score: 12.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.921
- Cytoplasmic Membrane Score: 0.0009
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.078
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.018074
- TAT(Tat/SPI): 0.000813
- LIPO(Sec/SPII): 0.000918
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000282467 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MYNKVIMIGRLTSTPELHKTNNDKSVARATIAVNRRYKDQNGEREADFVNMVLWGRLAETLASYATKGSLISVDGELRTRRFEKNGQMNYVTEVLVTGFQLLESRAQRAMRENNAGQDLADLVLEEEELPF
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_1711 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]