Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 02-OCT-2023
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae BVJ1JL
- locus tag: JN057_00922 [new locus tag: JN057_RS04490 ]
- pan locus tag?: PNEUPAN001917000
- symbol: yabA
- pan gene symbol?: yabA
- synonym:
- product: Initiation-control protein YabA
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JN057_00922 [new locus tag: JN057_RS04490 ]
- symbol: yabA
- product: Initiation-control protein YabA
- replicon: chromosome
- strand: +
- coordinates: 873816..874133
- length: 318
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: CP071871 (873816..874133) NCBI
- BioCyc:
- MicrobesOnline:
- PneumoBrowse for strain D39V: SPV_0827 PneumoBrowse
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGGACAAAAAAGAATTATTTGACGCGCTGGATGATTTTTCCCAACAATTATTGGTAACC
TTGGCCGATGTGGAAGCCATCAAGAAAAATCTCAAGAGCCTGGTAGAGGAAAATACAGCT
CTTCGCTTGGAAAATAGTAAGTTGCGAGAACGCTTGGGTGAGGTGGAAGCAGACGCTCCC
GTCAAGGCCAAGCATGTTCGCGAAAGTGTCCGTCGTATTTACCGTGATGGATTTCACGTA
TGTAATGATTTTTATGGACAACGTCGAGAGCAGGACGAAGAATGTATGTTCTGTGATGAG
TTGTTATACAGGGAGTAG60
120
180
240
300
318
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JN057_00922 [new locus tag: JN057_RS04490 ]
- symbol: YabA
- description: Initiation-control protein YabA
- length: 105
- theoretical pI: 4.72766
- theoretical MW: 12410.9
- GRAVY: -0.72381
⊟Function[edit | edit source]
- TIGRFAM: SH3 domain protein (TIGR04211; HMM-score: 14.2)Signal transduction PTS PTS IIA-like nitrogen-regulatory protein PtsN (TIGR01419; HMM-score: 12.9)Mobile and extrachromosomal element functions Plasmid functions integrating conjugative element protein, PFL_4705 family (TIGR03752; HMM-score: 12.3)two transmembrane protein (TIGR04527; HMM-score: 11.7)
- TheSEED: data available for D39, Hungary19A-6, TIGR4
- PFAM: no clan defined YabA; Initiation control protein YabA (PF06156; HMM-score: 105.4)and 7 moreHAP1_N; HAP1 N-terminal conserved region (PF04849; HMM-score: 18.4)DegS; Sensor protein DegS (PF05384; HMM-score: 16.8)TSC22; TSC-22/dip/bun family (PF01166; HMM-score: 16.4)NYD-SP28_assoc; Sperm tail C-terminal domain (PF14775; HMM-score: 14.8)DUF4201; Domain of unknown function (DUF4201) (PF13870; HMM-score: 14.7)HMMR_C; Hyaluronan mediated motility receptor C-terminal (PF15908; HMM-score: 14.1)NEMO; NF-kappa-B essential modulator NEMO (PF11577; HMM-score: 13.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9923
- Cytoplasmic Membrane Score: 0.0033
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0041
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.0025
- TAT(Tat/SPI): 0.000453
- LIPO(Sec/SPII): 0.000334
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: QTE32540 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MDKKELFDALDDFSQQLLVTLADVEAIKKNLKSLVEENTALRLENSKLRERLGEVEADAPVKAKHVRESVRRIYRDGFHVCNDFYGQRREQDEECMFCDELLYRE
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_0827 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.