Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 17-DEC-2024
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae Taiwan19F-14
- locus tag: SPT_RS07660 [old locus tag: SPT_1542 ]
- pan locus tag?: PNEUPAN003003000
- symbol: SPT_RS07660
- pan gene symbol?: phnA
- synonym:
- product: zinc ribbon domain-containing protein YjdM
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SPT_RS07660 [old locus tag: SPT_1542 ]
- symbol: SPT_RS07660
- product: zinc ribbon domain-containing protein YjdM
- replicon: chromosome
- strand: -
- coordinates: 1466296..1466634
- length: 339
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NC_012469 (1466296..1466634) NCBI
- BioCyc: SPT_RS07660 BioCyc
- MicrobesOnline: see SPT_1542
- PneumoBrowse for strain D39V: SPV_1427 PneumoBrowse
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAACAATTTACCAAATTGTCCAAAATGTAACTCAGAGTATGTCTACGAAGACGGTGCC
CTACTGGTTTGCCCAGAGTGTGCTCATGAGTGGAATCCTGCTGAAGTTGCAGAAGTAGAA
GAAGGTCTTGTCGCTATCGATGCCAACGGAAATAAATTGACTGATGGTGATACAGTAACT
CTCATCAAGGACTTGAAAGTAAAAGGTGCGCCAAAAGATTTGAAACAAGGGACGCGCGTG
AAAAATATCCGCATCGTAGAAGGCGACCACAATATCGACTGTAAGATTGATGGTTTTGGT
GCCATGGAACTTAAATCAGAGTTTGTGAGGAAGATTTAA60
120
180
240
300
339
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SPT_RS07660 [old locus tag: SPT_1542 ]
- symbol: SPT_RS07660
- description: zinc ribbon domain-containing protein YjdM
- length: 112
- theoretical pI: 4.62694
- theoretical MW: 12315
- GRAVY: -0.386607
⊟Function[edit | edit source]
- TIGRFAM: Unknown function General putative alkylphosphonate utilization operon protein PhnA (TIGR00686; HMM-score: 165.9)and 3 moreflagellar operon protein TIGR03826 (TIGR03826; HMM-score: 17.2)Transcription Transcription factors transcription factor S (TIGR01384; HMM-score: 15.6)Regulatory functions DNA interactions putative regulatory protein, FmdB family (TIGR02605; HMM-score: 8.3)
- TheSEED: see SPT_1542
- PFAM: SH3 (CL0010) YjdM; PhnA domain (PF03831; HMM-score: 111)and 16 moreZn_Beta_Ribbon (CL0167) YjdM_Zn_Ribbon; PhnA Zinc-Ribbon (PF08274; HMM-score: 59.7)TF_Zn_Ribbon; TFIIB zinc-binding (PF08271; HMM-score: 17.3)no clan defined FtrD-like; Membrane iron-sulfur containing protein FtrD-like (PF10080; HMM-score: 17.1)Zn_Beta_Ribbon (CL0167) A2L_zn_ribbon; A2L zinc ribbon domain (PF08792; HMM-score: 16.2)zf-RRN7; Zinc-finger of RNA-polymerase I-specific TFIIB, Rrn7 (PF11781; HMM-score: 14.9)zf-TFIIB; Transcription factor zinc-finger (PF13453; HMM-score: 14.8)zinc_ribbon_4; zinc-ribbon domain (PF13717; HMM-score: 13.1)zinc-ribbons_6; zinc-ribbons (PF07191; HMM-score: 12.9)OrfB_Zn_ribbon; Putative transposase DNA-binding domain (PF07282; HMM-score: 12.9)HeH (CL0306) PADR1; PADR1 (NUC008) domain (PF08063; HMM-score: 12.6)Zn_Beta_Ribbon (CL0167) UPF0547; Uncharacterised protein family UPF0547 (PF10571; HMM-score: 12.5)TFIIS_C; Transcription factor S-II (TFIIS) (PF01096; HMM-score: 11.7)no clan defined FYDLN_acid; Protein of unknown function (FYDLN_acid) (PF09538; HMM-score: 11.3)Zn_Beta_Ribbon (CL0167) Zn_Tnp_IS1595; Transposase zinc-ribbon domain (PF12760; HMM-score: 11)Zn_Tnp_IS1; InsA N-terminal domain (PF03811; HMM-score: 10.4)Zn-ribbon_8; Zinc ribbon domain (PF09723; HMM-score: 9.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9483
- Cytoplasmic Membrane Score: 0.0088
- Cell wall & surface Score: 0.0006
- Extracellular Score: 0.0422
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.013035
- TAT(Tat/SPI): 0.000275
- LIPO(Sec/SPII): 0.002127
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_001061593 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNNLPNCPKCNSEYVYEDGALLVCPECAHEWNPAEVAEVEEGLVAIDANGNKLTDGDTVTLIKDLKVKGAPKDLKQGTRVKNIRIVEGDHNIDCKIDGFGAMELKSEFVRKI
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CcpA see SPT_1542
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_1427 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟'lacZ' fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]