Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 23-APR-2025
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae TIGR4
- locus tag: SP_RS13505 [old locus tag: SP_1918 ]
- pan locus tag?: PNEUPAN003521000
- symbol: SP_RS13505
- pan gene symbol?: —
- synonym:
- product: ABC transporter ATP-binding protein/permease
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SP_RS13505 [old locus tag: SP_1918 ]
- symbol: SP_RS13505
- product: ABC transporter ATP-binding protein/permease
- replicon: chromosome
- strand: -
- coordinates: 1827828..1828859
- length: 1032
- essential: unknown
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021ATGGGCTTCCTTCTCATGGGAGCACTCTTCATCGTTCTTCCCCGAACTATGGTCTCTGCT
AAGCGGATTAATCAAGTTTTAGATTTGCATTCTTCTATCCAAAACCCTGTTCAAGTGCAG
CTGACTGATGAAAACTTCAAAGGTCAGGTCGAGTTTAAGGATGTGACCTTCCGCTATGCG
GCAAATTCGGAGGCAGTTATTGAACATGTTAGCTTTAAAGCAGAAACTGGTCAAACAGTG
GCCTTTATTGGGTCAACAGGTTCTGGTAAATCAACTCTGGTCAATCTGATTCCACGTTTC
TACGACGTGTCAGCAGGAGAAATTCTGGTGGACGGTGTCAATGTTCAAGACTATGACTTC
TCTGCGACAGCTCATGCTGGTCAAAAGGTTGCCATTGTTGGGCCGACTGGGGCTGGTAAG
ACAACCATTGTCAATCTTTTGATGAAATTCTATGAGATTGATAAGGGAAGTATTCGCATT
GATGGTGTGGATACCAAGGCTATGACGCGTTCAGAAGTGCATGATGCCTTTTCAATGGTC
TTGCAGGATACCTGGCTCTTTGAAGGAACTATTCGAGACAATCTCATCTATAATCAAATA
GGGATTAGTGATGAACGAATGATGGAAGCTAGTAAGGCTGTGGGAATTCACCACTTTATT
ATGACCTTGCCAGATGGCTATGATACCATCTTGGATGACACCGTGACCTTGTCTGTAAGA
CAAAAACAACTATTGACTATTGCTCGTGCCCTTCTTAAGGATGCACCGCTTTTGATTTTG
GATGAGGCGACTTCTTCTGTTGACACACGGACAGAGGAATTGATCCAAAAAGCCATGGAC
CGTTTGATGGAAGGACGCACATCCTTTGTCATTGCCCACCGCTTGTCAACCATCCGAAAT
GCAGACTTGATCTTGGTCATGAAAGATGGAAATATCATCGAGCAAGGCAACTATGAGGAA
CTGATGGCGCAAGGTGGCTTCTACGCTGACTTGTACAATAGTCAATTTACAGAAGATGAA
GCAGAAGAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1032
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SP_RS13505 [old locus tag: SP_1918 ]
- symbol: SP_RS13505
- description: ABC transporter ATP-binding protein/permease
- length: 343
- theoretical pI: 4.52632
- theoretical MW: 38006
- GRAVY: -0.0294461
⊟Function[edit | edit source]
- TIGRFAM: Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 347.7)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 347.7)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 331.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 291.1)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 283.1)and 106 moreTransport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 278.1)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 277.7)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 277.7)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 267.7)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 267.7)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 255.1)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 255.1)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 229.2)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 229.2)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 229.2)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 223.2)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 208.4)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 192.9)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 172.2)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 142.7)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 133.2)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 127.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 119.1)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 116.6)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 116.6)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 116.6)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 114.9)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 107.5)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 104.6)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 100.4)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 91.9)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 91.7)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 91.1)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 91)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 91)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 90.8)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 90.1)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 89.8)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 89.8)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 88.5)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 86.1)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 82.8)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 81.5)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 81.4)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 81)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 81)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 80.6)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 79.6)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 79.2)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 78.6)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 78)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 78)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 77)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 76)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 73.8)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 72.4)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 72)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 70.2)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 70.2)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 66.6)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 66.6)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 64.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 63.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 58.8)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 57.5)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 54.6)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 46.7)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 46)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 44.4)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 30.5)Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 27.9)Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 27.1)Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 25.8)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 23.9)Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 23.4)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 22.8)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 21.7)Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 21.6)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 21.2)Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 21.1)Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 21)Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 20.5)Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 19.9)DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 19.9)Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 19.1)nicotinamide-nucleotide adenylyltransferase (TIGR01526; EC 2.7.7.1; HMM-score: 18.5)Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 18)Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 17.8)Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 17.3)Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 17.3)Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 17.2)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 16.7)Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 16.3)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 16.2)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 15.9)Protein fate Protein modification and repair hydrogenase accessory protein HypB (TIGR00073; HMM-score: 15.8)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 15.2)Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 15)Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 15)type-IV secretion system protein TraC (TIGR02746; HMM-score: 14.5)flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 14.1)Cell envelope Surface structures twitching motility protein (TIGR01420; HMM-score: 13.8)Cellular processes Chemotaxis and motility twitching motility protein (TIGR01420; HMM-score: 13.8)helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 13.7)Cellular processes Pathogenesis type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 13.6)Protein fate Protein and peptide secretion and trafficking type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 13.6)Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 13.6)DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 13.5)putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 13)Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 12.6)Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 12.4)
- TheSEED: see SP_1918
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 142.1)and 66 moreRsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 40.3)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 33.6)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 31.7)AAA_22; AAA domain (PF13401; HMM-score: 31.1)AAA_23; AAA domain (PF13476; HMM-score: 30.7)AAA_24; AAA domain (PF13479; HMM-score: 29.8)AAA_16; AAA ATPase domain (PF13191; HMM-score: 29.5)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 29.4)AAA_30; AAA domain (PF13604; HMM-score: 28.2)AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 25.8)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 25.7)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 25.3)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 25.2)DUF87; Helicase HerA, central domain (PF01935; HMM-score: 25)AAA_18; AAA domain (PF13238; HMM-score: 24.3)AAA_33; AAA domain (PF13671; HMM-score: 24.3)AAA_10; AAA-like domain (PF12846; HMM-score: 23.9)AAA_19; AAA domain (PF13245; HMM-score: 23.9)NTPase_1; NTPase (PF03266; HMM-score: 23)DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 22.7)AAA_28; AAA domain (PF13521; HMM-score: 22.2)ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 22.1)Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 22.1)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 21.7)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 21.1)ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 21)FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 20.6)NB-ARC; NB-ARC domain (PF00931; HMM-score: 20.5)Dynamin_N; Dynamin family (PF00350; HMM-score: 19.9)DO-GTPase2; Double-GTPase 2 (PF19993; HMM-score: 19.8)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 19.4)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 19.4)AAA_14; AAA domain (PF13173; HMM-score: 19.3)RNA_helicase; RNA helicase (PF00910; HMM-score: 19.1)DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 18.7)cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 18.3)ABC_ATPase; ATPase of the ABC class (PF09818; HMM-score: 18.2)AAA_15; AAA ATPase domain (PF13175; HMM-score: 18)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 17.9)NACHT; NACHT domain (PF05729; HMM-score: 17.7)SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 17.6)dNK; Deoxynucleoside kinase (PF01712; HMM-score: 17.4)P-loop_TraG; TraG P-loop domain (PF19044; HMM-score: 16.8)G-alpha; G-protein alpha subunit (PF00503; HMM-score: 16.2)AAA_17; AAA domain (PF13207; HMM-score: 15.5)Septin; Septin (PF00735; HMM-score: 15.3)PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 15.3)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 15.1)AAA_25; AAA domain (PF13481; HMM-score: 14.9)GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 14.8)FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 14.6)TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 14.4)Rad17; Rad17 P-loop domain (PF03215; HMM-score: 14.3)APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 14)ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 13.9)IIGP; Interferon-inducible GTPase (IIGP) (PF05049; HMM-score: 13.9)no clan defined VP1_VP3; Structural protein VP1/VP3 (PF06281; HMM-score: 13.9)P-loop_NTPase (CL0023) IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13.8)MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 13.2)no clan defined DUF6495; Family of unknown function (DUF6495) (PF20105; HMM-score: 13.1)P-loop_NTPase (CL0023) TniB; Bacterial TniB protein (PF05621; HMM-score: 12.4)Pentapeptide (CL0505) Pentapeptide_4; Pentapeptide repeats (9 copies) (PF13599; HMM-score: 12.3)P-loop_NTPase (CL0023) KAP_NTPase; KAP family P-loop domain (PF07693; HMM-score: 12.1)DUF3584; Protein of unknown function (DUF3584) (PF12128; HMM-score: 12.1)SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 12)Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 11.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0017
- Cytoplasmic Membrane Score: 0.9925
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0056
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.446762
- TAT(Tat/SPI): 0.009334
- LIPO(Sec/SPII): 0.036433
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MGFLLMGALFIVLPRTMVSAKRINQVLDLHSSIQNPVQVQLTDENFKGQVEFKDVTFRYAANSEAVIEHVSFKAETGQTVAFIGSTGSGKSTLVNLIPRFYDVSAGEILVDGVNVQDYDFSATAHAGQKVAIVGPTGAGKTTIVNLLMKFYEIDKGSIRIDGVDTKAMTRSEVHDAFSMVLQDTWLFEGTIRDNLIYNQIGISDERMMEASKAVGIHHFIMTLPDGYDTILDDTVTLSVRQKQLLTIARALLKDAPLLILDEATSSVDTRTEELIQKAMDRLMEGRTSFVIAHRLSTIRNADLILVMKDGNIIEQGNYEELMAQGGFYADLYNSQFTEDEAEE
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: SlyA_2* see SP_1918
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V:
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 Indu Warrier, Nikhil Ram-Mohan, Zeyu Zhu, Ariana Hazery, Haley Echlin, Jason Rosch, Michelle M Meyer, Tim van Opijnen
The Transcriptional landscape of Streptococcus pneumoniae TIGR4 reveals a complex operon architecture and abundant riboregulation critical for growth and virulence.
PLoS Pathog: 2018, 14(12);e1007461
[PubMed:30517198] [WorldCat.org] [DOI] (I e)