Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 09-DEC-2016
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae SP49
- locus tag: BMJ42_01459 [new locus tag: BMJ42_RS07720 ]
- pan locus tag?: PNEUPAN002789000
- symbol: atpC
- pan gene symbol?: atpC
- synonym:
- product: proton-translocating ATPase, F1 sector, epsilon-subunit
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: BMJ42_01459 [new locus tag: BMJ42_RS07720 ]
- symbol: atpC
- product: proton-translocating ATPase, F1 sector, epsilon-subunit
- replicon: chromosome
- strand: -
- coordinates: 1388303..1388722
- length: 420
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: CP018136 (1388303..1388722) NCBI
- BioCyc: see BMJ42_RS07720
- MicrobesOnline:
- PneumoBrowse for strain D39V: SPV_1334 PneumoBrowse
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGGCTCAGTTAACTGTCCAGATCGTGACACCAGATGGTCTCGTCTATGATCACCATGCC
AGCTATGTATCGGTTCGAACTCTGGATGGTGAGATGGGGATCTTGCCACGACATGAAAAT
ATGATTGCGGTTTTAGCAGTTGATGAAGTAAAGGTAAAACGTATCGATGATAAAGATCAC
GTGAACTGGATTGCAGTAAACGGTGGCGTTATTGAAATTGCCAATGATATGATCACAATC
GTCGCTGACTCTGCAGAACGTGCTCGTGATATCGATATCAGTCGTGCAGAACGTGCCAAA
CTTCGTGCAGAACGTGCAATTGAAGAAGCACAAGACAAACATTTGATTGACCAAGAACGT
CGTGCTAAGATTGCTTTGCAACGTGCTATTAACCGTATTAATGTCGGAAATAGACTATAA60
120
180
240
300
360
420
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: BMJ42_01459 [new locus tag: BMJ42_RS07720 ]
- symbol: AtpC
- description: proton-translocating ATPase, F1 sector, epsilon-subunit
- length: 139
- theoretical pI: 6.35817
- theoretical MW: 15637.8
- GRAVY: -0.264748
⊟Function[edit | edit source]
- reaction: EC 3.6.3.14? ExPASyH+-transporting two-sector ATPase ATP + H2O + H+(In) = ADP + phosphate + H+(Out)
- TIGRFAM: Energy metabolism ATP-proton motive force interconversion ATP synthase F1, epsilon subunit (TIGR01216; EC 3.6.3.14; HMM-score: 98.7)and 1 morealternate F1F0 ATPase, F1 subunit epsilon (TIGR03166; EC 3.6.3.-; HMM-score: 27.2)
- TheSEED: data available for D39, Hungary19A-6, TIGR4
- PFAM: no clan defined ATP-synt_DE_N; ATP synthase, Delta/Epsilon chain, beta-sandwich domain (PF02823; HMM-score: 89.7)and 1 moreATP-synt_DE; ATP synthase, Delta/Epsilon chain, long alpha-helix domain (PF00401; HMM-score: 52.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8268
- Cytoplasmic Membrane Score: 0.1394
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0336
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002701
- TAT(Tat/SPI): 0.000119
- LIPO(Sec/SPII): 0.000381
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: APJ30755 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MAQLTVQIVTPDGLVYDHHASYVSVRTLDGEMGILPRHENMIAVLAVDEVKVKRIDDKDHVNWIAVNGGVIEIANDMITIVADSAERARDIDISRAERAKLRAERAIEEAQDKHLIDQERRAKIALQRAINRINVGNRL
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- data available for TIGR4
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_1334 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]