Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 30-NOV-2024
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae EF3030
- locus tag: EF3030_RS03385 [old locus tag: EF3030_03385 ]
- pan locus tag?: PNEUPAN001642000
- symbol: EF3030_RS03385
- pan gene symbol?: ykoD
- synonym:
- product: ATP-binding cassette domain-containing protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EF3030_RS03385 [old locus tag: EF3030_03385 ]
- symbol: EF3030_RS03385
- product: ATP-binding cassette domain-containing protein
- replicon: chromosome
- strand: +
- coordinates: 643314..644699
- length: 1386
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NZ_CP035897 (643314..644699) NCBI
- BioCyc: EF3030_RS03385 BioCyc
- MicrobesOnline:
- PneumoBrowse for strain D39V: SPV_0626 PneumoBrowse
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381ATGGGTCTGGAACTACGAGCGATTCAGTCCCCAATCTTCTCTGAGCCGTTTGATTTTACT
TTTCATGCGCAAGCCTTTACCTTGTTAGTTGGGAGCAGTGGTTCAGGAAAATCCAGCCTT
TTTCAAGTCATTGCCCAAGTCAGTTCTCTTCCCTATAGTGGTCAAGTCCTGATAGATGGG
AGCGAGGTCAGTCAGCTTTCTATCATCGCACGTGTCCAGAAGGTTGGCATTCTCTTTCAA
AATCCCAATCATCAATTTACCATGGAGAACTTGTTTGAGGAGCTGATTTTCACCTTGGAG
AATATCGGCTATCACCTTCAGGAAATTGATTCTAAAATAGCAGAGGTTGTCCAGCAATGT
CGTTGCGAGGCAATCTTACACCGTCCCATTCATCACCTATCAGGTGGGGAAAAGCAAAAA
GCAGCGCTGGCTGTCCTCTTTGCCATGAATCCTAGGGTCTATCTCTTGGATGAGCCCTTC
GCTTCTATTGACCGCAAGAGCAGAATCGAGATATTGGAGATTCTAAAAGAGTTGGCTCTT
GATGGGAAGACAGTTATTTTGTGCGACCATGATTTATCTGACTATAAAGCCTATATCGAC
CATATGGTTGAGCTAAGAGACGGAAAACTAAGGGAAGTGTTTCAAATCCCTTCCTATGAG
ATGACACAGGTTGCTTCAAAGGAAGTTGCTTCTAGCCCGGAACTATTCCATATGAACCGT
GTGACTGGTGAGCTTGGTAATCGCCCCCTCTTTTCAATTGCTGATTTCACATTCTATCAA
GGGATTTCCTGTATCCTGGGTGACAATGGTGTCGGGAAATCAACCCTCTTTCGCTCTATT
CTTCAATTTCAAAAGTATAAGGGGCGCATTGCATGGAAGGGGACAGTCCTGAAAAAGAAA
AAGAGTTTGTATCGTGATCTGACTGGTGTTGTTCAGGAAGCTGAGAAGCAGTTTATCCGA
GTCAGTCTGCGAGAGGAGCTTCAATTAGATGGACCTGATTCTGAAAGAAATCAGCGGATT
TTTCAAGCTTTACGATATTTTGATTTGGAGCAGGCAGTCGATAAGAGTCCCTATCAATTA
AGTGGTGGTCAGCAAAAAATTCTTCAGCTCTTGACCATCTTGACCAGTAAGGCTTCCGTG
ATCTTGCTAGATGAACCTTTTGCAGGTTTGGATGATAGAGCCTGCCATTATTTTTGCAAG
TGGATTGTGGAGGAGAGGAATCAAGGAAGAAGTTTTCTGCTCATTAGTCATCGTTTAGAC
CCTTTGATTTCTGTGGTTGATTATTGGATTGAGATGACTAGTCAGGGTCTTCGGCATGTG
AAAGAAGTGACCATTACCAAACCACTTACATCTCAGAGTAGCAATACCCAAGGGGAGGTG
AGATAG60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1320
1380
1386
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EF3030_RS03385 [old locus tag: EF3030_03385 ]
- symbol: EF3030_RS03385
- description: ATP-binding cassette domain-containing protein
- length: 461
- theoretical pI: 6.651
- theoretical MW: 52281.7
- GRAVY: -0.139262
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 223.4)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 205.2)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 195.8)and 82 moreCellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 163.7)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 163.7)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 152.9)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 151.4)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 147.8)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 142)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 140.1)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 138.7)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 138.7)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 137.8)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 137.8)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 134.6)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 134.5)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 134.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 132.6)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 132.4)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 129.5)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 129.5)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 126.6)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 126.6)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 126.3)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 126)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 125.9)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 125.7)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 120.7)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 119.5)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 112)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 111.6)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 111.2)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 110.1)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 110.1)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 109.1)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 107.6)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 107.6)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 106.3)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 104.6)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 99.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 97.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 89.4)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 89.4)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 89.3)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 85.8)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 85.8)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 84.3)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 83.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 83.5)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 81.7)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 81.6)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 80.8)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 77.5)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 73.2)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 73.2)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 73)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 72.7)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 72.7)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 72.3)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 72.3)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 70.3)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 70.3)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 70.3)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 64.6)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 56.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 47.1)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 44.8)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 40.5)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 39.4)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 35.8)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 31.6)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 28.9)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 25.7)Hypothetical proteins Conserved TIGR02680 family protein (TIGR02680; HMM-score: 24.6)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 20.1)Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 18.4)Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 18.2)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 18.2)restriction system-associated AAA family ATPase (TIGR04435; HMM-score: 17.3)DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 16.3)Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 15)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 15)DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 15)DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvA (TIGR00084; EC 3.6.4.12; HMM-score: 13.6)Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 12)
- TheSEED: data available for D39, Hungary19A-6, TIGR4
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 159.7)and 38 moreAAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 78.8)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 73.7)AAA_23; AAA domain (PF13476; HMM-score: 37.9)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 37.3)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 35)AAA_16; AAA ATPase domain (PF13191; HMM-score: 32.5)AAA_22; AAA domain (PF13401; HMM-score: 31.8)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 27.6)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 23.6)AAA_15; AAA ATPase domain (PF13175; HMM-score: 23.4)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 22.5)NACHT; NACHT domain (PF05729; HMM-score: 22)RNA_helicase; RNA helicase (PF00910; HMM-score: 20.8)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 20.5)Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 20.4)AAA_18; AAA domain (PF13238; HMM-score: 17.6)AAA_33; AAA domain (PF13671; HMM-score: 16.8)G-alpha; G-protein alpha subunit (PF00503; HMM-score: 16.2)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 16.1)DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 16.1)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 16)ATPase; KaiC (PF06745; HMM-score: 15.9)NB-ARC; NB-ARC domain (PF00931; HMM-score: 15.3)AAA_28; AAA domain (PF13521; HMM-score: 15.3)AAA_27; AAA domain (PF13514; HMM-score: 15.2)DUF87; Helicase HerA, central domain (PF01935; HMM-score: 14.9)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 14.6)AAA_30; AAA domain (PF13604; HMM-score: 14.5)DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 14.4)Septin; Septin (PF00735; HMM-score: 13.9)MCM; MCM P-loop domain (PF00493; HMM-score: 13.6)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 13.2)FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 13)NTPase_1; NTPase (PF03266; HMM-score: 12.9)AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 12.9)AAA_25; AAA domain (PF13481; HMM-score: 12.6)no clan defined Peptidase_M3_N; Oligopeptidase F (PF08439; HMM-score: 12.5)P-loop_NTPase (CL0023) AAA_10; AAA-like domain (PF12846; HMM-score: 11.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.6282
- Cytoplasmic Membrane Score: 0.3696
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.002
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.026644
- TAT(Tat/SPI): 0.03342
- LIPO(Sec/SPII): 0.006134
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000522101 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MGLELRAIQSPIFSEPFDFTFHAQAFTLLVGSSGSGKSSLFQVIAQVSSLPYSGQVLIDGSEVSQLSIIARVQKVGILFQNPNHQFTMENLFEELIFTLENIGYHLQEIDSKIAEVVQQCRCEAILHRPIHHLSGGEKQKAALAVLFAMNPRVYLLDEPFASIDRKSRIEILEILKELALDGKTVILCDHDLSDYKAYIDHMVELRDGKLREVFQIPSYEMTQVASKEVASSPELFHMNRVTGELGNRPLFSIADFTFYQGISCILGDNGVGKSTLFRSILQFQKYKGRIAWKGTVLKKKKSLYRDLTGVVQEAEKQFIRVSLREELQLDGPDSERNQRIFQALRYFDLEQAVDKSPYQLSGGQQKILQLLTILTSKASVILLDEPFAGLDDRACHYFCKWIVEERNQGRSFLLISHRLDPLISVVDYWIEMTSQGLRHVKEVTITKPLTSQSSNTQGEVR
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- data available for TIGR4
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_0626 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]