Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 31-JAN-2014
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae TIGR4
- locus tag: SP_1517 [new locus tag: SP_RS07470 ]
- pan locus tag?: PNEUPAN002800000
- symbol: greA
- pan gene symbol?: greA
- synonym:
- product: transcription elongation factor GreA
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SP_1517 [new locus tag: SP_RS07470 ]
- symbol: greA
- product: transcription elongation factor GreA
- replicon: chromosome
- strand: -
- coordinates: 1424808..1425290
- length: 483
- essential: yes [1] DEG
⊟Accession numbers[edit | edit source]
- Location: AE005672 (1424808..1425290) NCBI
- BioCyc:
- MicrobesOnline: 116966 MicrobesOnline
- PneumoBrowse for strain D39V: SPV_1345 PneumoBrowse
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481ATGGCAGAAAAAACATATCCTATGACCCTTGAGGAAAAGGAAAAACTTGAAAAAGAATTA
GAAGAATTGAAATTGGTTCGTCGACCAGAAGTGGTAGAACGCATTAAGATTGCCCGTTCA
TACGGTGACCTTTCAGAAAACAGTGAGTACGAAGCAGCTAAGGATGAACAAGCCTTTGTC
GAAGGACAAATCTCTAGCTTAGAAACAAAAATCCGCTATGCTGAAATCGTCAATAGCGAC
GCAGTTGCCCAGGACGAAGTAGCGATTGGTAAAACAGTCACCATCCAAGAAATTGGTGAG
GACGAAGAAGAAGTTTATATTATCGTAGGTTCAGCTGGTGCAGATGCCTTTGTAGGTAAG
GTTTCAAATGAAAGCCCAATTGGGCAGGCCTTGATTGGCAAGAAAACAGGTGATACAGCA
ACCATTGAAACGCCTGTTGGTAGCTATGATGTAAAAATCTTGAAGGTTGAAAAAACAGCC
TAA60
120
180
240
300
360
420
480
483
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SP_1517 [new locus tag: SP_RS07470 ]
- symbol: GreA
- description: transcription elongation factor GreA
- length: 160
- theoretical pI: 4.2199
- theoretical MW: 17571.6
- GRAVY: -0.40625
⊟Function[edit | edit source]
- TIGRFAM: Transcription Transcription factors transcription elongation factor GreA (TIGR01462; HMM-score: 185.8)and 1 moreTranscription Transcription factors transcription elongation factor GreB (TIGR01461; HMM-score: 84)
- TheSEED :
- Transcription elongation factor GreA
- PFAM: no clan defined GreA_GreB_N; Transcription elongation factor, N-terminal (PF03449; HMM-score: 94.9)FKBP (CL0487) GreA_GreB; Transcription elongation factor, GreA/GreB, C-term (PF01272; HMM-score: 87.5)and 2 moreBET (CL0665) BET; Bromodomain extra-terminal - transcription regulation (PF17035; HMM-score: 14.7)OB (CL0021) DNA_ligase_OB; NAD-dependent DNA ligase OB-fold domain (PF03120; HMM-score: 13.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9969
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0028
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002695
- TAT(Tat/SPI): 0.000623
- LIPO(Sec/SPII): 0.000571
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MAEKTYPMTLEEKEKLEKELEELKLVRRPEVVERIKIARSYGDLSENSEYEAAKDEQAFVEGQISSLETKIRYAEIVNSDAVAQDEVAIGKTVTIQEIGEDEEEVYIIVGSAGADAFVGKVSNESPIGQALIGKKTGDTATIETPVGSYDVKILKVEKTA
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription[edit | edit source]
- transcription start site: 1425359 [2]
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_1345 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟'lacZ' fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Jane A Thanassi, Sandra L Hartman-Neumann, Thomas J Dougherty, Brian A Dougherty, Michael J Pucci
Identification of 113 conserved essential genes using a high-throughput gene disruption system in Streptococcus pneumoniae.
Nucleic Acids Res: 2002, 30(14);3152-62
[PubMed:12136097] [WorldCat.org] [DOI] (I p)Tim van Opijnen, Andrew Camilli
A fine scale phenotype-genotype virulence map of a bacterial pathogen.
Genome Res: 2012, 22(12);2541-51
[PubMed:22826510] [WorldCat.org] [DOI] (I p) - ↑ 2.0 2.1 2.2 Indu Warrier, Nikhil Ram-Mohan, Zeyu Zhu, Ariana Hazery, Haley Echlin, Jason Rosch, Michelle M Meyer, Tim van Opijnen
The Transcriptional landscape of Streptococcus pneumoniae TIGR4 reveals a complex operon architecture and abundant riboregulation critical for growth and virulence.
PLoS Pathog: 2018, 14(12);e1007461
[PubMed:30517198] [WorldCat.org] [DOI] (I e)