Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 31-JAN-2014
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae TIGR4
- locus tag: SP_1512 [new locus tag: SP_RS07445 ]
- pan locus tag?: PNEUPAN002794000
- symbol: atpF
- pan gene symbol?: atpF
- synonym:
- product: ATP synthase F0, B subunit
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SP_1512 [new locus tag: SP_RS07445 ]
- symbol: atpF
- product: ATP synthase F0, B subunit
- replicon: chromosome
- strand: -
- coordinates: 1420917..1421411
- length: 495
- essential: yes [1] other strains
⊟Accession numbers[edit | edit source]
- Location: AE005672 (1420917..1421411) NCBI
- BioCyc:
- MicrobesOnline: 116962 MicrobesOnline
- PneumoBrowse for strain D39V: SPV_1339 PneumoBrowse
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481ATGCACGTAACAGTAGGTGAATTAATTGGTAATTTTATTTTAATCACTGGCTCTTTTATT
CTTTTGCTAGTCTTGATTAAAAAATTTGCATGGTCTAATATTACAGGCATTTTCGAAGAA
AGAGCTGAAAAAATTGCTTCAGATATTGACAGAGCTGAAGAAGCCCGTCAAAAAGCAGAA
GTATTGGCTCAAAAACGCGAAGATGAATTGGCTGGTAGCCGTAAAGAAGCTAAGACAATC
ATTGAAAATGCAAAGGAAACAGCTGAGCAAAGTAAGGCTAATATCTTAGCAGATGCTAAA
CTAGAAGCAGGACACTTAAAAGAAAAAGCCAATCAAGAAATTGCTCAAAATAAAGTAGAA
GCTTTACAGAGTGTTAAGGGTGAGGTCGCAGATTTGACCATCAGCTTAGCTGGTAAAATC
ATCTCACAAAACCTTGACAGTCATGCCCATAAAGCACTCATTGATCAGTATATCGATCAG
CTAGGAGAAGCTTAA60
120
180
240
300
360
420
480
495
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SP_1512 [new locus tag: SP_RS07445 ]
- symbol: AtpF
- description: ATP synthase F0, B subunit
- length: 164
- theoretical pI: 5.11586
- theoretical MW: 17986.4
- GRAVY: -0.218902
⊟Function[edit | edit source]
- reaction: EC 3.6.3.14? ExPASyH+-transporting two-sector ATPase ATP + H2O + H+(In) = ADP + phosphate + H+(Out)
- TIGRFAM: Energy metabolism ATP-proton motive force interconversion ATP synthase F0, B subunit (TIGR01144; EC 3.6.3.14; HMM-score: 133.3)and 6 morealternate F1F0 ATPase, F0 subunit B (TIGR03321; EC 3.6.3.-; HMM-score: 57)Transcription Degradation of RNA ribonuclease Y (TIGR03319; EC 3.1.-.-; HMM-score: 15)Cellular processes Pathogenesis protein TolA (TIGR02794; HMM-score: 10.7)Transport and binding proteins Other protein TolA (TIGR02794; HMM-score: 10.7)flagellar assembly protein FliH (TIGR03825; HMM-score: 9.7)ATP synthase archaeal, H subunit (TIGR02926; EC 3.6.3.14; HMM-score: 9.5)
- TheSEED :
- ATP synthase F0 sector subunit b (EC 7.1.2.2)
- PFAM: ATP_synthase (CL0255) ATP-synt_B; ATP synthase B/B' CF(0) (PF00430; HMM-score: 94)and 7 moreno clan defined RNase_Y_N; RNase Y N-terminal region (PF12072; HMM-score: 17.5)OmpH; Outer membrane protein (OmpH-like) (PF03938; HMM-score: 16.1)DUF2018; Domain of unknown function (DUF2018) (PF09442; HMM-score: 15)ATP_synthase (CL0255) Mt_ATP-synt_B; Mitochondrial ATP synthase B chain precursor (ATP-synt_B) (PF05405; HMM-score: 10.6)no clan defined MAT1; CDK-activating kinase assembly factor MAT1 (PF06391; HMM-score: 10.4)DUF4570; Domain of unknown function (DUF4570) (PF15134; HMM-score: 9.2)DivIVA; DivIVA protein (PF05103; HMM-score: 7.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9969
- Cell wall & surface Score: 0
- Extracellular Score: 0.003
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.067917
- TAT(Tat/SPI): 0.001356
- LIPO(Sec/SPII): 0.003767
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MHVTVGELIGNFILITGSFILLLVLIKKFAWSNITGIFEERAEKIASDIDRAEEARQKAEVLAQKREDELAGSRKEAKTIIENAKETAEQSKANILADAKLEAGHLKEKANQEIAQNKVEALQSVKGEVADLTISLAGKIISQNLDSHAHKALIDQYIDQLGEA
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CcpA regulon
CcpA (TF) important in Global catabolite repression; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_1339 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟'lacZ' fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Tim van Opijnen, Andrew Camilli
A fine scale phenotype-genotype virulence map of a bacterial pathogen.
Genome Res: 2012, 22(12);2541-51
[PubMed:22826510] [WorldCat.org] [DOI] (I p) - ↑ 2.0 2.1 Indu Warrier, Nikhil Ram-Mohan, Zeyu Zhu, Ariana Hazery, Haley Echlin, Jason Rosch, Michelle M Meyer, Tim van Opijnen
The Transcriptional landscape of Streptococcus pneumoniae TIGR4 reveals a complex operon architecture and abundant riboregulation critical for growth and virulence.
PLoS Pathog: 2018, 14(12);e1007461
[PubMed:30517198] [WorldCat.org] [DOI] (I e)