Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 17-DEC-2024
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae A66
- locus tag: A66_RS03975 [old locus tag: A66_00798 ]
- pan locus tag?: PNEUPAN001836000
- symbol: A66_RS03975
- pan gene symbol?: —
- synonym:
- product: DUF6556 family protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: A66_RS03975 [old locus tag: A66_00798 ]
- symbol: A66_RS03975
- product: DUF6556 family protein
- replicon: chromosome
- strand: -
- coordinates: 766665..767093
- length: 429
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NZ_LN847353 (766665..767093) NCBI
- BioCyc:
- MicrobesOnline:
- PneumoBrowse for strain D39V: SPV_0775 PneumoBrowse
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGTCTAACTATCGTAGAACTTCAAAACCGAAAACAGAACATATCAAAAAAGGCTTTACT
GTTTTTCAAAAAACCATTACTACTATCGGTAGTATCCTTGGTTTGATTACCGCGGGTATC
ACGATCATGAACGCCTTGGATAATAATAATAAAAATACTAAAAAAGAACCTACGACAAGC
CAGACGACAACCTTTGTCAAAGAAATTCAAAAAGAATCCCCTCAGGAAAATACTACTCCA
AATAAGGAAAATAACACTTCTCAAGAAAAAACACAACAAGAAGAAACGCCAAAATCTAGC
GTCAAGGAAGAGAAAAAAGAAGATCAGAAAACAGCAACTCAGGACTCTACTACACCTGCT
ACAAGTAAACCTGCCACTGAAAATGAAAAACAGCCCAATACTCCAACTTCAGAAAATAAT
ACTCAATGA60
120
180
240
300
360
420
429
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: A66_RS03975 [old locus tag: A66_00798 ]
- symbol: A66_RS03975
- description: DUF6556 family protein
- length: 142
- theoretical pI: 9.79874
- theoretical MW: 15847.3
- GRAVY: -1.41761
⊟Function[edit | edit source]
- TIGRFAM: mobilome CxxCx(11)CxxC protein (TIGR04402; HMM-score: 12.9)integral membrane protein (TIGR04561; HMM-score: 11.9)and 5 moreTranscription Degradation of RNA ribonuclease Y (TIGR03319; EC 3.1.-.-; HMM-score: 10)Cellular processes Pathogenesis putative immunoglobulin-blocking virulence protein (TIGR04526; HMM-score: 7.6)Energy metabolism TCA cycle dihydrolipoyllysine-residue succinyltransferase, E2 component of oxoglutarate dehydrogenase (succinyl-transferring) complex (TIGR01347; EC 2.3.1.61; HMM-score: 7.1)cobaltochelatase subunit (TIGR02442; EC 6.6.1.2; HMM-score: 6.7)pullulanase, extracellular (TIGR02102; HMM-score: 5.4)
- TheSEED: data available for D39, Hungary19A-6, TIGR4
- PFAM: no clan defined DUF6556; Family of unknown function (DUF6556) (PF20193; HMM-score: 97.7)and 21 moreTrbC_VirB2 (CL0690) DUF4134; Domain of unknown function (DUF4134) (PF13572; HMM-score: 16.8)no clan defined DUF3807; Protein of unknown function (DUF3807) (PF12720; HMM-score: 13.2)DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 13)Multiheme_cytos (CL0317) C_GCAxxG_C_C; Putative redox-active protein (C_GCAxxG_C_C) (PF09719; HMM-score: 12.3)no clan defined DUF5427; Family of unknown function (DUF5427) (PF10310; HMM-score: 11.4)GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 8.5)AhpD-like (CL0423) PA26; PA26 p53-induced protein (sestrin) (PF04636; HMM-score: 8.3)no clan defined RR_TM4-6; Ryanodine Receptor TM 4-6 (PF06459; HMM-score: 8.3)Neur_chan_memb; Neurotransmitter-gated ion-channel transmembrane region (PF02932; HMM-score: 8.2)CIS_TMP; Contractile injection system tape measure protein (PF19268; HMM-score: 7.5)Serinc; Serine incorporator (Serinc) (PF03348; HMM-score: 7.2)vMSA; Major surface antigen from hepadnavirus (PF00695; HMM-score: 7.1)SLC12; Solute carrier family 12 (PF03522; HMM-score: 7.1)DDHD; DDHD domain (PF02862; HMM-score: 7)APC (CL0062) HCO3_cotransp; HCO3- transporter family (PF00955; HMM-score: 6.7)TPR (CL0020) Suf; Suppressor of forked protein (Suf) (PF05843; HMM-score: 6.7)no clan defined Snu56_snRNP; Snu56-like U1 small nuclear ribonucleoprotein component (PF19097; HMM-score: 6.1)Nucleocapsid (CL0156) Paramyxo_ncap; Paramyxovirus nucleocapsid protein (PF00973; HMM-score: 5.5)Peptidase_AD (CL0130) Presenilin; Presenilin (PF01080; HMM-score: 5.1)no clan defined DUF4551; Protein of unknown function (DUF4551) (PF15087; HMM-score: 5)Golgi_traff (CL0456) Hid1; High-temperature-induced dauer-formation protein (PF12722; HMM-score: 4.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0054
- Cytoplasmic Membrane Score: 0.5204
- Cell wall & surface Score: 0.2867
- Extracellular Score: 0.1876
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.405518
- TAT(Tat/SPI): 0.014053
- LIPO(Sec/SPII): 0.020374
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000073931 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MSNYRRTSKPKTEHIKKGFTVFQKTITTIGSILGLITAGITIMNALDNNNKNTKKEPTTSQTTTFVKEIQKESPQENTTPNKENNTSQEKTQQEETPKSSVKEEKKEDQKTATQDSTTPATSKPATENEKQPNTPTSENNTQ
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_0775 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]