Jump to navigation
Jump to search
PangenomeTIGR4
serotype 4
D39serotype 2
D39Vserotype 2
Hungary19A-6serotype 19A
EF3030serotype 19F
670-6Bserotype 6B
6A-10serotype 6A
70585serotype 5
A026serotype 19F
A66serotype 3
AP200serotype 11A
ASP0581serotype 12F
ATCC 49619serotype 19F
ATCC 700669serotype 23F
BM6001serotype 19F
BVJ1JLserotype 1
CGSP14serotype 14
G54serotype 19F
HU-OHserotype 3
Hu15serotype 19A
Hu17serotype 19A
INV104serotype 1
INV200serotype 14
JJAserotype 14
MDRSPN001serotype 19F
NCTC7465serotype 1
NCTC7466serotype 2
NU83127serotype 4
OXC141serotype 3
P1031serotype 1
R6serotype 2
SP49serotype 19A
SPN032672serotype 1
SPN034156serotype 3
SPN034183serotype 3
SPN994038serotype 3
SPN994039serotype 3
SPNA45serotype 3
ST556serotype 19F
TCH8431/19Aserotype 19A
Taiwan19F-14serotype 19F
Xen35serotype 4
gamPNI0373serotype 1
NCBI: 03-APR-2017
⊟Summary[edit | edit source]
- organism: Streptococcus pneumoniae Hu15
- locus tag: SPNHU15_00926 [new locus tag: SPNHU15_RS04335 ]
- pan locus tag?: PNEUPAN001836000
- symbol: SPNHU15_00926
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SPNHU15_00926 [new locus tag: SPNHU15_RS04335 ]
- symbol: SPNHU15_00926
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 872190..872624
- length: 435
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: CP020551 (872190..872624) NCBI
- BioCyc:
- MicrobesOnline:
- PneumoBrowse for strain D39V: SPV_0775 PneumoBrowse
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGTCTAATTATCGTAGAACTTCAAAACCAAAAACAGAACACATCAAAAAAGGCTTTACA
GTCTTTCAAAAAACCGTTGCGACTATCGCTAGTATCCTTGGCTTGATTACCGCTAGTATC
ACGATTATGAACGCCTTGGATAATAACAAAAATACTAAAAAGGAACCTACAACAAGCCAG
ACGACAACAATTGTCAAAGAAATTCAAAAGGAATCCCCTCAGGAAAATACTAGTCCCAAT
AAGGAAAATAAGACTTCTCAAGAAAAAACACAACAAGAAGAAACGCCAAAATCCAGCGTC
AAGGAAGAGAAAAAAGAAGAGCAGAAAACATCAACTCAGGATTCTTCTACTCCTGCTCCT
ACTCCAAGTAAACCTGCTACTGAAAACGAAAAACAGTCCAATACCCCAACTTCGGAAAAT
AAAACTAATCAATAA60
120
180
240
300
360
420
435
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SPNHU15_00926 [new locus tag: SPNHU15_RS04335 ]
- symbol: SPNHU15_00926
- description: hypothetical protein
- length: 144
- theoretical pI: 10.104
- theoretical MW: 16027.6
- GRAVY: -1.4
⊟Function[edit | edit source]
- TIGRFAM: mobilome CxxCx(11)CxxC protein (TIGR04402; HMM-score: 16.8)and 8 morecobaltochelatase subunit (TIGR02442; EC 6.6.1.2; HMM-score: 12.8)Transcription Degradation of RNA ribonuclease Y (TIGR03319; EC 3.1.-.-; HMM-score: 9)Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobaltochelatase, CobT subunit (TIGR01651; EC 6.6.1.2; HMM-score: 8.3)Cellular processes Pathogenesis putative immunoglobulin-blocking virulence protein (TIGR04526; HMM-score: 6.5)mycoides cluster lipoprotein, LppA/P72 family (TIGR03490; HMM-score: 6.3)pullulanase, extracellular (TIGR02102; HMM-score: 5.7)integral membrane protein (TIGR04561; HMM-score: 4.6)Energy metabolism TCA cycle dihydrolipoyllysine-residue succinyltransferase, E2 component of oxoglutarate dehydrogenase (succinyl-transferring) complex (TIGR01347; EC 2.3.1.61; HMM-score: 4.3)
- TheSEED: data available for D39, Hungary19A-6, TIGR4
- PFAM: no clan defined DUF6556; Family of unknown function (DUF6556) (PF20193; HMM-score: 104)and 25 morePep1_7; Elicitor peptide 1-7 (PF17232; HMM-score: 19.6)MFS (CL0015) BT1; BT1 family (PF03092; HMM-score: 14.9)HTH (CL0123) DUF2551; Protein of unknown function (DUF2551) (PF10826; HMM-score: 13.8)SGNH_hydrolase (CL0264) Lipase_GDSL_3; GDSL-like Lipase/Acylhydrolase family (PF14606; HMM-score: 13.1)DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 12.7)no clan defined MotA_ExbB; MotA/TolQ/ExbB proton channel family (PF01618; HMM-score: 12.2)Ycf1; Ycf1 (PF05758; HMM-score: 9.8)O-anti_assembly (CL0499) O-antigen_lig; O-antigen ligase like membrane protein (PF13425; HMM-score: 9.5)no clan defined Neur_chan_memb; Neurotransmitter-gated ion-channel transmembrane region (PF02932; HMM-score: 9.4)Miga; Mitoguardin (PF10265; HMM-score: 9.1)GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 9.1)GT-B (CL0113) FUT8_N_cat; Alpha-(1,6)-fucosyltransferase N- and catalytic domains (PF19745; HMM-score: 8.5)no clan defined vMSA; Major surface antigen from hepadnavirus (PF00695; HMM-score: 8)Serinc; Serine incorporator (Serinc) (PF03348; HMM-score: 8)MPDZ_u10; Unstructured region 10 on multiple PDZ protein (PF16667; HMM-score: 7.8)Shisa; Wnt and FGF inhibitory regulator (PF13908; HMM-score: 7.7)DUF5427; Family of unknown function (DUF5427) (PF10310; HMM-score: 7.6)CIS_TMP; Contractile injection system tape measure protein (PF19268; HMM-score: 7.4)RR_TM4-6; Ryanodine Receptor TM 4-6 (PF06459; HMM-score: 6.9)DDHD; DDHD domain (PF02862; HMM-score: 6.4)MFS (CL0015) CLN3; CLN3 protein (PF02487; HMM-score: 6.3)AhpD-like (CL0423) PA26; PA26 p53-induced protein (sestrin) (PF04636; HMM-score: 5.6)Peptidase_AD (CL0130) Presenilin; Presenilin (PF01080; HMM-score: 5.4)no clan defined SLC12; Solute carrier family 12 (PF03522; HMM-score: 5.4)DUF4551; Protein of unknown function (DUF4551) (PF15087; HMM-score: 5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helix: 1
- DeepLocPro: Cell wall & surface
- Cytoplasmic Score: 0.0112
- Cytoplasmic Membrane Score: 0.3913
- Cell wall & surface Score: 0.432
- Extracellular Score: 0.1656
- SignalP: Signal peptide SP(Sec/SPI) length 45 aa
- SP(Sec/SPI): 0.57298
- TAT(Tat/SPI): 0.023284
- LIPO(Sec/SPII): 0.017124
- Cleavage Site: CS pos: 45-46. MNA-LD. Pr: 0.4813
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: ARD36717 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MSNYRRTSKPKTEHIKKGFTVFQKTVATIASILGLITASITIMNALDNNKNTKKEPTTSQTTTIVKEIQKESPQENTSPNKENKTSQEKTQQEETPKSSVKEEKKEEQKTSTQDSSTPAPTPSKPATENEKQSNTPTSENKTNQ
⊟Experimental data[edit | edit source]
- protein localization:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription[edit | edit source]
- transcription start site:
⊟Expression data[edit | edit source]
- PneumoExpress for strain D39V: SPV_0775 PneumoExpress
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]